Pteris vittata
speciesAt a glance
Occurrence records14 537
Data sources13
Biological traits37
DNA specimens45
eDNA detections50
Sources13 archives
Databases and archives Pteris vittata's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility14 537 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI50 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics45 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources37 traits
Chemical compositionLOTUS · NPASS24 compounds
Occurrence & distributionGBIF14 537 records
Environmental DNA2 datasets · 4 countries50 detections
DNA & barcodingBOLD · NCBI45 specimens
Genome at a glanceCCDB6.6 Gbp
01Narrative
Pteris vittata est une des espèces de fougère du genre Pteris. Cette espèce est exceptionnellement résistante à l'arsenic, qu'elle peut en outre fortement bioaccumuler ce métal. Ce processus est encore dopé en présence de phosphore et d'autres métaux lourds ou métalloïdes, ce qui en fait une plante potentiellement intéressante pour la phytoremédiation. Elle a été introduite en Amérique du Nord où elle se développe bien. Trois régions où des taux anormaux d'arsenic dans les sols sont fréquents en raison de l'usage ancien et contemporain de pesticides à base d'arsenic, arséniate de plomb autrefois, et méthanearséniate monosodique ou méthanearséniate disodique aujourd'hui.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPAusTraitsGIFTTRY
Size & morphology9
Leaf length150 mm
Leaf length max800 mm
Leaf length min300 mm
Leaf width10 mm
Leaf width max150 mm
Leaf width min100 mm
Plant height0.825 m
Plant height max1.51 m
Plant height min0.1 m
Life cycle & reproduction9
Dispersal typewind
Flowering endAug
Flowering startMar
Life formperennial or rhizomatous geophyte
Life spanperennial
Lifespan years100 years
Pollination syndromeabiotic
Raunkiær life formcryptophyte
Resprouting capacityfire_killed
Diet & foraging1
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatesubtropical
Climberself-supporting
Elevation max1 900 m
Elevation min0 m
Epiphyteterrestrial
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: fern · TRY: F
Habitat GIFTÁrea Antrópica, Floresta de Terra Firme, Floresta Ombrófila (= Floresta Pluvial)
Leaf compoundnesscompound
Leaf formelliptic
Leaf shapedeltate narrowly_oblong
Succulenceno
Woodinessnon-woody
Physiology & chemistry5
Leaf n19.18 mg/g
Leaf p0.71 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)14.81 mm²/mg
03Chemical composition24 compounds
Compounds documented for Pteris vittata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Monomeric stilbenes6
Carotenoids (C40, β-β)5
Flavonols4
Phenanthrenes3
Furanoid lignans1
Documented compounds24 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (2R,3S,4S,5S,6R)-2-[[(2S,3R,4R)-2-(4-hydroxy-3-methoxyphenyl)-4-[(4-hydroxy-3-methoxyphenyl)methyl]oxolan-3-yl]methoxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| (3R,3'R,13-cis)-beta,beta-Carotene-3,3'-diol | present | LOTUS | |
| 3,3'-Dihydroxy-2,6-bis(4-hydroxybenzyl)-5-methoxybibenzyl | present | NPASS | |
| 4-Hydroxybenzaldehyde | present | NPASS | |
| [(1S,3R,6R,8S,11R,12S,15R,16R)-7,7,12,16-tetramethyl-15-[(2R)-6-methylhept-5-en-2-yl]-6-pentacyclo[9.7.0.01,3.03,8.012,16]octadecanyl] (E)-3-(4-hydroxyphenyl)prop-2-enoate | present | NPASS | |
| Adonixanthin | present | LOTUS | |
| Arundin | present | NPASS | |
| Arundinin | present | NPASS | |
| Batatasin Iii | present | NPASS | |
| Blestriarene A | present | NPASS |
05DNA & barcoding45 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pteris vittata has left across the world's sequence archives.
At a glance
DNA specimens45
Marker genes5
GenBank sequences10
eDNA detections50
Countries6
The DNA barcodea real sequence read deposited for this species
GGAAGTAAAAGTCGTAACAAGGTCTCCGTAGGTGAACCTGCGGAGGGATCATTACAAGTGACCCCGGTCTAACCACCGGGATGTTCATAA …
UNVERIFIED_ORG: Pteris vittata ecotype YC 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★rbcL9★rbcLa★ITS1★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Pteris vittata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size6 630 840 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Pteris vittata6.63 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 116 n = 58
Chromosome records58–1742n range116median116mode22records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 11615×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2
CCDB · book-ipcn65 — Kurita 1963
CCDB · ipcn-api-dl — Srivastava, R. B. 1985. Ferns of the Indo-Nepal border. Proc. Roy. Soc. Edinburgh, Sect. B, Biol. Sci. 86: 471–472.
CCDB · ipcn-api-dl — Nakato, N. & M. Kato. 2001. Chromosome numbers of ten species of ferns from Guam, S. Mariana Isls. Acta Phytotax. Geobot. 52(2): 125–133.
CCDB · book-ipcn67-71 — ROY, R.P., B.M.B. SINHA, & A.R. SAKYA. 1971. Cytology of some ferns of Kathmandu valley. Brit. Fern Gaz. 10: 193-199.
CCDB · book-LoveLove1977 — Manton & Sledge 1954
CCDB · book-LoveLove1977 — Manton 1959
CCDB · book-LoveLove1977 — Mehra & Verma 1960
CCDB · book-LoveLove1977 — Wagner 1963
CCDB · book-LoveLove1977 — Verma & Goloknath (in Love 1967b)
CCDB · book-LoveLove1977 — Mitui 1968
CCDB · book-LoveLove1977 — Roy, R. P., Sinha & Sakya 1971
CCDB · CromoCat 2015 — Badré, F. & Deschatres, R. (1979). Les Ptéridophytes de la France, liste commentée des espèces (taxonomie, cytologie, écologie et répartition générale). Candollea 34: 379-457.
CCDB · CromoCat 2015 — Nakato, N. & M. Kato (2001). Chromosome numbers of ten species of ferns from Guam, S. Mariana Isls Acta Phytotax. Geobot. 52(2): 125–133
CCDB · CromoCat 2015 — Roy, R. P., B. M. B. Sinha & A. R. Sakya. (1971). Cytology of some ferns of Kathmandu valley. Brit. Fern Gaz. 10: 193-199.
CCDB · CromoCat 2015 — Srivastava, R. B. (1985). Ferns of the Indo-Nepal border. Proc. Roy. Soc. Edinburgh, sec. B. Biol. 86: 471-472
2n 585×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Kato, M., N. Nakato, X. Cheng & K. Iwatsuki. 1992. Cytotaxonomic study of ferns of Yunnan, southwestern China. Bot. Mag. (Tokyo) 105: 105–124.
CCDB · ipcn-api-dl — Ammal, L. S. & K. V. Bhavanandan. 1991. Cytological studies on some members of Pteridaceae (sensu Copeland) from south India. Indian Fern J. 8: 87–92.
CCDB · CromoCat 2015 — Ammal, L. S. & Bhavanandan, K. V. (1991). Cytological studies on some members of Pteridaceae (sensu Copeland) from south India Indian Fern J. 8: 87–92
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
CCDB · CromoCat 2015 — Kato, M., Nakato, N., Cheng, X. & Iwatsuki, K. (1992). Cytotaxonomic study of ferns of Yunnan, southwestern China. Bot. Mag. (Tokyo) 105: 105-124
2n 872×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Chang, Y. j., W. C. Shieh & J. l. Tsai. 1992. Studies on the karyotypes of the fern genus Pteris in Taiwan. Pp. 93–109 <in> J.–l. Tsai & W.–c. Shieh (editors), Proceedings of the Second Seminar on Asian Pteridology Taiwan 17–22 March 1992. National Chung Hsing University and National Science Council.
CCDB · CromoCat 2015 — Chang, Y-J., Shieh, W.-C. & Tsai, J.-L. (1992). Studies on the karyotypes of the fern genus Pteris in Taiwan. Pp. 93-109 in J.-l. Tsai & W. C. Shieh (editors), Proceedings of the Second Seminar on Asian Pteridology Taiwan 17-22 March 1992. National Chung
2n 1742×CCDB · ita-fl · CCDB · CromoCat 2015
CCDB · ita-fl — BRULLO S., DE LEONARDIS W., PAVONE P. - 1982. Chromosome numbers of some sicilian ferns. 1.. Webbia , 35(2): 275-281.
CCDB · CromoCat 2015 — Brullo, S., Leonardis, de, W. & Pavone, P. (1982). Chromosome numbers of some Sicilian ferns. 1. Webbia 35: 275-281.
n 5823×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +5
CCDB · book-ipcn65 — Kurita 1963
CCDB · book-ipcn65 — Verma & K. 1965; Brownlie 1965
CCDB · ipcn-api-dl — Punetha, N. & A. Sen. 1989. Cytological observations on some species of Pteris L. from Kumaon (northwest Himalaya). Proc. Indian Acad. Sci., Pl. Sci. 99(2): 131–134.
CCDB · ipcn-api-dl — Manickam, V. S. 1984. Cytology of thirty species of ferns from the Palni Hills (South India). Cytologia 49: 49–59.
CCDB · ipcn-api-dl — Raj, V. I. & V. S. Manickam. 1987. SOCGI plant chromosome number reports -- IV [i.e., V]. J. Cytol. Genet. 22: 156–161.
CCDB · ipcn-api-dl — Srivastava, R. B. 1985. Ferns of the Indo-Nepal border. Proc. Roy. Soc. Edinburgh, Sect. B, Biol. Sci. 86: 471–472.
CCDB · ipcn-api-dl — Weng, R. F. 1985. Observation on chromosomes of some Chinese ferns. J. Wuhan Bot. Res. 3(4): 367–370.
CCDB · ipcn-api-dl — Khullar, S. P., S. S. Sharma & S. C. Verma. 1988. SOCGI plant chromosome number reports -- VI. J. Cytol. Genet. 23: 38–52.
CCDB · ipcn-api-dl — Punetha, N. 1989. Cytological observations on ferns of Kumaon (N. W. Himalaya). Aspects Pl. Sci. 11: 459–465.
CCDB · ipcn-api-dl — Rajkumar, S. D. 2001. IOPB chromosome data 17. Newslett. Int. Organ. Pl. Biosyst. (Pruhonice) 33: 25–26.
CCDB · ipcn-api-dl — Mitui, K. 1976a. Chromosome numbers of some ferns in the Ryukyu Islands. J. Jap. Bot. 51: 33–41.
CCDB · book-ipcn67-71 — MITUI, K. 1968. Chromosomes and speciation in ferns. Sci. Rep. Tokyo Kyoiku Daigaku Sect. B 13: 285-333.
CCDB · book-ipcn67-71 — VERMA, S. C., & M. GOLOKNATH. 1967. In IOPB chromosome number reports X. Taxon 16: 146-157.
CCDB · book-ipcn67-71 — ROY, R.P., B.M.B. SINHA, & A.R. SAKYA. 1971. Cytology of some ferns of Kathmandu valley. Brit. Fern Gaz. 10: 193-199.
CCDB · book-ipcn75-78 — Mitui l 976a
CCDB · Cave1956supp — Manton & Sledge 1954
CCDB · Cave1962 — T. G. Walker 1962a
CCDB · Cave1963 — Brownlie in Fabbri 1963; Wagner 1963b
CCDB · CromoCat 2015 — Rajkumar, S. D. (2001). IOPB Chromosome Data 17 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 33: 25-26.
CCDB · CromoCat 2015 — Mitui, K. (1968). Chromosomes and speciation in ferns. Sci. Rep. Tokyo Kyoiku Daigaku Sect. B 13: 285-333.
CCDB · CromoCat 2015 — Roy, R. P., B. M. B. Sinha & A. R. Sakya. (1971). Cytology of some ferns of Kathmandu valley. Brit. Fern Gaz. 10: 193-199.
CCDB · CromoCat 2015 — Verma, S. C. & M. Goloknath. (1967). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports X]. Taxon 16(2): 146-157.
CCDB · CromoCat 2015 — Verma, S. C. & S. P. Khullar. (1965). Cytology of some W. Himalayan Adiantaceae (sensu Alston) with cytotaxonomic comments. Caryologia 18: 85-106.
n 875×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · Cave1962 +1
CCDB · ipcn-api-dl — GHATAK, J. 1977. Biosystematic survey of pteridophytes from Shevaroy Hills, south India. Nucleus 20: 105–108.
CCDB · book-ipcn75-78 — Ghatak 1977
CCDB · Cave1962
CCDB · CromoCat 2015 — Ghatak, J. (1977). Biosystematic survey of pteridophytes from Shevaroy Hills, south India Nucleus 20: 105–108
CCDB · CromoCat 2015 — Verma, S. C. & S. P. Khullar. (1965). Cytology of some W. Himalayan Adiantaceae (sensu Alston) with cytotaxonomic comments. Caryologia 18: 85-106.
n 293×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Ammal, L. S. & K. V. Bhavanandan. 1991. Cytological studies on some members of Pteridaceae (sensu Copeland) from south India. Indian Fern J. 8: 87–92.
CCDB · CromoCat 2015 — Ammal, L. S. & Bhavanandan, K. V. (1991). Cytological studies on some members of Pteridaceae (sensu Copeland) from south India Indian Fern J. 8: 87–92
CCDB · CromoCat 2015 — Verma, S. C. & S. P. Khullar. (1965). Cytology of some W. Himalayan Adiantaceae (sensu Alston) with cytotaxonomic comments. Caryologia 18: 85-106.
08Occurrence & distribution
Record type14 537 records
Wild obs. + sensor9 878
Museum / vouchered4 511
Cultivated / captive4
Other144
Origin
Native206
Introduced178
Range
Area of Occupancy AOO25 616 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy82% within 1 km
≤100 m 4 791≤1 km 1 090≤10 km 937>10 km 375
7 193 georeferenced · 2 685 without coordinates
Open the mapobservation + sensor9 878
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy48% within 1 km
≤100 m 104≤1 km 163≤10 km 206>10 km 78
551 georeferenced · 3 960 without coordinates
Open the institutions mapphysical evidence4 511
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤1 km 1
1 georeferenced · 3 without coordinates
Open the mapnot free-living4
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions160 of 291 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Beijing, CN | 539 |
| Chengdu, CN | 371 |
| Yangling, CN | 125 |
| Tsukuba, JP | 110 |
| Guangzhou, CN | 94 |
| Saint Louis, US | 84 |
| MeiseBGlocation not on record | 83 |
| Taipei, TW | 79 |
| Wuhan, CN | 78 |
| Tampa, US | 76 |
| Nishihara, JP | 76 |
| Paris, FR | 75 |
| Pretoria, ZA | 74 |
| Nanjing, CN | 73 |
| Bronx, US | 70 |
| Chicago, US | 69 |
| Yunnan Universitylocation not on record | 65 |
| National Museum of Natural Sciencelocation not on record | 64 |
| South Kensington, GB | 57 |
| Guilin, CN | 49 |
| Auckland, NZ | 48 |
| Canberra, AU | 46 |
| UnBlocation not on record | 43 |
| LDlocation not on record | 42 |
| Miami, US | 42 |
| Brisbane, AU | 37 |
| Seoul, KR | 37 |
| UNESP, Campus São José Rio Prêtolocation not on record | 36 |
| Université de Bordeauxlocation not on record | 36 |
| Cape Town, ZA | 35 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 34 |
| Museo Entomologico de Leonlocation not on record | 33 |
| Odawara, JP | 33 |
| University of Stellenboschlocation not on record | 32 |
| Jena Microbial Resource Collectionlocation not on record | 31 |
| Mount Annan, AU | 30 |
| València, ES | 29 |
| Chapel Hill, US | 29 |
| MAlocation not on record | 29 |
| Wellington, NZ | 28 |
| Chengdu, CN | 27 |
| Xian, CN | 24 |
| Guatemala City, GT | 24 |
| WNNUlocation not on record | 23 |
| Salvador, BR | 23 |
| TAIElocation not on record | 23 |
| Edinburgh, GB | 22 |
| Blumenau, BR | 21 |
| UFMGlocation not on record | 21 |
| EEZA-CSIClocation not on record | 20 |
| UNESP-RClocation not on record | 17 |
| CASlocation not on record | 17 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 16 |
| Kensington, AU | 16 |
| Durban, ZA | 16 |
| Guiyang, CN | 15 |
| Nishihara, JP | 15 |
| Fort Worth, US | 15 |
| Berlin, DE | 14 |
| Jiangxi Universitylocation not on record | 14 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 14 |
| Osaka, JP | 13 |
| Minia, EG | 13 |
| Claremont, US | 12 |
| Riverside, US | 12 |
| Granada, ES | 12 |
| Austin, US | 12 |
| Viña del Mar, CL | 11 |
| Kew, GB | 11 |
| Guiyang, CN | 11 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 11 |
| UFBAlocation not on record | 11 |
| Bloomington, US | 11 |
| Ann Arbor, US | 11 |
| Nanchong, CN | 10 |
| Taipei, TW | 10 |
| Wlocation not on record | 10 |
| Salamanca, ES | 10 |
| Xinxiang, CN | 10 |
| UFPRlocation not on record | 9 |
| Muzaffarabad, PK | 9 |
| UniKSlocation not on record | 9 |
| Lake Charles, US | 9 |
| Knoxville, US | 9 |
| Xining, CN | 9 |
| Philadelphia, US | 9 |
| WTUlocation not on record | 9 |
| Burlington, US | 8 |
| Wuhan, CN | 8 |
| Honolulu, US | 8 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 8 |
| GMBAlocation not on record | 8 |
| Columbia, US | 8 |
| TNMlocation not on record | 8 |
| JBRJlocation not on record | 8 |
| BIO-UNIPIlocation not on record | 8 |
| Olocation not on record | 8 |
| Antiguo Cuscatlán, SV | 8 |
| Entomological Society of Latvialocation not on record | 8 |
| GAlocation not on record | 7 |
| Jackson, US | 7 |
| Sevilla, ES | 7 |
| Santiago de Compostela, ES | 6 |
| BClocation not on record | 6 |
| Seychelles National Herbariumlocation not on record | 5 |
| Badajoz, ES | 5 |
| Xiangtan City, CN | 5 |
| UFMSlocation not on record | 5 |
| Shanghai, CN | 5 |
| UEMAlocation not on record | 5 |
| US | 5 |
| Zhengzhou, CN | 5 |
| Sendai, JP | 5 |
| Rotorua, NZ | 5 |
| Moscow State Universitylocation not on record | 5 |
| Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record | 5 |
| ASUlocation not on record | 5 |
| Clemson, US | 5 |
| Nagano City, JP | 5 |
| Adelaide, AU | 5 |
| Madrid, ES | 5 |
| San Diego, US | 5 |
| EL PASO, US | 5 |
| BISHlocation not on record | 5 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 5 |
| Cape Town, ZA | 5 |
| Instituto de Ecología y Sistemáticalocation not on record | 5 |
| Zhejiang Universitylocation not on record | 4 |
| Smithfield, AU | 4 |
| Corrientes, AR | 4 |
| Chengdu, CN | 4 |
| Campo Mourão, BR | 4 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 4 |
| Armidale, AU | 4 |
| Zürich, CH | 4 |
| Chongqing Museumlocation not on record | 4 |
| Hangzhou, CN | 4 |
| Fullerton, US | 4 |
| Palmerston, AU | 4 |
| Universidad de Orientelocation not on record | 4 |
| Xiamen, CN | 4 |
| Vitoria, ES | 4 |
| San Sebastián, ES | 4 |
| Ivano-Frankivsk, UA | 4 |
| Valdosta State Universitylocation not on record | 4 |
| Durango, MX | 4 |
| UFRPElocation not on record | 4 |
| UTFPR-CPlocation not on record | 4 |
| CEPLAClocation not on record | 4 |
| McWane Science Centerlocation not on record | 4 |
| Pontifícia Universidade Católica do Paranálocation not on record | 4 |
| Tuscaloosa, US | 3 |
| James Cook Townsvillelocation not on record | 3 |
| Laboratorio de Ictiologialocation not on record | 3 |
| UERJlocation not on record | 3 |
| Bangkok, TH | 3 |
| Brasília, BR | 3 |
| Uppsala, SE | 3 |
| WAGlocation not on record | 3 |
| Plocation not on record | 3 |
| BAYLUlocation not on record | 3 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 3 |
| Toyama, JP | 3 |
| Beijing Normal Universitylocation not on record | 3 |
| Jinghong, CN | 3 |
| Kochi, JP | 3 |
| College Park, US | 3 |
| Christchurch, NZ | 3 |
| IECOSlocation not on record | 3 |
| John T. Waterhouse Herbariumlocation not on record | 3 |
| San Isidro, AR | 3 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 3 |
| Instituto de Investigação Científica Tropicallocation not on record | 3 |
| Jishou Universitylocation not on record | 3 |
| Wollongong, AU | 3 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 3 |
| BDBClocation not on record | 3 |
| HAWlocation not on record | 3 |
| National Biodiversity Institute, Costa Ricalocation not on record | 2 |
| PUC-RIOlocation not on record | 2 |
| Lord Fairfax Community Collegelocation not on record | 2 |
| UIBlocation not on record | 2 |
| AUAlocation not on record | 2 |
| Turku, FI | 2 |
| UFOPlocation not on record | 2 |
| Foz do Iguaçu, BR | 2 |
| Cenargenlocation not on record | 2 |
| ESALQlocation not on record | 2 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 2 |
| GB | 2 |
| Tianjin Natural History Museumlocation not on record | 2 |
| Texas A&M Universitylocation not on record | 2 |
| Masindi, UG | 2 |
| UNISANTAlocation not on record | 2 |
| Universidade de São Paulolocation not on record | 2 |
| JBSlocation not on record | 2 |
| National Institute of Biological Resourceslocation not on record | 2 |
| US | 2 |
| Mexico City, MX | 2 |
| UNESP-FCAlocation not on record | 2 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 2 |
| Universidade Federale do Rio Grande do Sullocation not on record | 2 |
| Calabar, NG | 2 |
| Kagoshima, JP | 2 |
| Williamsburg, US | 2 |
| Santa Barbara, US | 2 |
| Baroda, IN | 2 |
| Shanghai, CN | 2 |
| Hanshan Normal Universitylocation not on record | 2 |
| Parkville, AU | 2 |
| Madison, US | 2 |
| Zhuzhou, CN | 2 |
| Ischia Marine Centrelocation not on record | 2 |
| Alicante, ES | 2 |
| Frankfurt am Main | 2 |
| St. Paul, US | 2 |
| Gijón, ES | 1 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 1 |
| UFSCarlocation not on record | 1 |
| UNEMATlocation not on record | 1 |
| Guizhou Forestry Schoollocation not on record | 1 |
| UNICAMPlocation not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Asheville, US | 1 |
| New Brunswick, US | 1 |
| Dehra Dun, IN | 1 |
| Northridge, US | 1 |
| Córdoba, ES | 1 |
| Central China Normal Universitylocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Departamento de Sistematica e Ecologialocation not on record | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| Mérida, MX | 1 |
| Provo, US | 1 |
| Ilhéus, BR | 1 |
| CUVClocation not on record | 1 |
| MMRSlocation not on record | 1 |
| Sanda, JP | 1 |
| Los Angeles, US | 1 |
| Bogotá, D.C., CO | 1 |
| Pittsburg, US | 1 |
| San Luis Obispo, US | 1 |
| La Société Guernesiaise, Priaulx Librarylocation not on record | 1 |
| Stockholm, SE | 1 |
| Barcelona, ES | 1 |
| Chiba, JP | 1 |
| Vancouver, CA | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| Smithsonian Institution, National Museum of Natural Historylocation not on record | 1 |
| University of Santo Tomas Herbariumlocation not on record | 1 |
| IAPlocation not on record | 1 |
| Universidade Paulistalocation not on record | 1 |
| Chongqing Natural History Museumlocation not on record | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Mississippi State, US | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Museu Paraense Emílio Goeldilocation not on record | 1 |
| Juriquilla, MX | 1 |
| Universidade Federal de Goiáslocation not on record | 1 |
| Kawasaki Shi Tama Ku, JP | 1 |
| Shenzhen, CN | 1 |
| UFPElocation not on record | 1 |
| Tilburg, NL | 1 |
| Guiyang, CN | 1 |
| UFRRJlocation not on record | 1 |
| FPMZBlocation not on record | 1 |
| Flagstaff, US | 1 |
| GRAlocation not on record | 1 |
| GJOlocation not on record | 1 |
| Edmonton, CA | 1 |
| BRLUlocation not on record | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| HUAlocation not on record | 1 |
| MEXUlocation not on record | 1 |
| Cascavel, BR | 1 |
| Moscow, US | 1 |
| TAFORI-LSRClocation not on record | 1 |
| Rishon Le Zion, IL | 1 |
| Dekalb, US | 1 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 1 |
| Due West, US | 1 |
| Córdoba, AR | 1 |
| USP-IBlocation not on record | 1 |
| Feira de Santana, BR | 1 |
| San Francisco, US | 1 |
| Université de Strasbourglocation not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| LNBG$location not on record | 1 |
| Brasília, BR | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
291 institutions · 4 263 of 4 511 vouchered records shown · 247 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA50 detections
Where the DNA of Pteris vittata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found50
Studies independent surveys2
Countries4
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 50 detections have coordinates
Open the map4 countries0
Sparse, mostly introduced weeds, bay bottom …
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median18.2 °C 16.2–22.5
Seasonal swing summer↔winter21.2 °C
Max temp (day)25.6 °C 20.2–26.7
Min temp (night)12.2 °C 12.2–18.5
Precipitation31.3 mm/mo 9.00–245
Air humidity56.4 % 51.6–61.5
Moisture balance-21.0 mm/mo -66.4–89.3
Vapour deficit1,007 Pa 796–1,046
Wind speed2.00 m/s 2.00–3.00
Cloud cover27.1 % 26.4–53.2
CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.