Pteris umbrosa

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Polypodiopsida/Polypodiales/Pteridaceae/Pteris

At a glance

Occurrence records1 599

Data sources6

Biological traits20

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Pteris umbrosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 599 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Occurrence & distributionGBIF1 599 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 116

01Narrative

سرخس برگ بیدی(نام علمی: Pteris umbrosa) نام یک گونه از تیره پرسرخسیان است.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsGIFTTRY

Size & morphology5

Leaf length300 mm

Leaf length max300 mm

Leaf width12.5 mm

Plant height2.5 m

Seed mass0.001 mg

Life cycle & reproduction4

Dispersal typewind

Life spanperennial

Pollination syndromeabiotic

Resprouting capacityresprouts

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formfern

Leaf compoundnesscompound

Leaf shapelinear

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pteris umbrosa has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKF289648.1 ↗1 278 bp

ACGT

GATTACCGATTGACTTATTACACTCCCGAATACAAGACCAAAGATACTGATATCTTAGCGGCTTTCCGAATGACCCCACAACCTGGAGTA …

Pteris umbrosa voucher PterisI. Forster, 28107 ribulose-1,5-bisphoshpate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL4

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Pteris umbrosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 116 n = 58

Chromosome records116–1162n range116median116mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1164×CCDB · ipcn-api-dl · CCDB · book-LoveLove1977 · CCDB · Cave1957

CCDB · ipcn-api-dl — Tindale. 2002. In M. D. Tindale & S. K. Roy, A cytotaxonomic survey of the Pteridophyta of Australia. Austral. Syst. Bot. 15: 839–937.

CCDB · book-LoveLove1977 — Schifferdecker 1957

CCDB · book-LoveLove1977 — Walker, T. G. 1962a

CCDB · Cave1957 — Schifferdeoker

n 581×CCDB · Cave1962

CCDB · Cave1962 — T. G. Walker 1962a

n 1161×CCDB · Cave1957

CCDB · Cave1957 — Schifferdeoker

08Occurrence & distribution

Record type1 599 records

Wild obs. + sensor1 196

Museum / vouchered385

Cultivated / captive3

Other15

Origin

Native66

Introduced4

Range

Area of Occupancy AOO3 764 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 953≤1 km 97≤10 km 88>10 km 3

1 141 georeferenced · 55 without coordinates

Open the mapobservation + sensor1 196

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 52≤1 km 70≤10 km 175>10 km 45

342 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence385

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 2 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	125
Mount Annan, AU	66
Canberra, AU	57
Brisbane, AU	49
Smithfield, AU	16
Armidale, AU	13
Adelaide, AU	12
Hobart, AU	6
John T. Waterhouse Herbariumlocation not on record	6
Wollongong, AU	6
Parkville, AU	5
Auckland, NZ	4
Batemans Bay, AU	4
Wellington, NZ	3
La Trobe Universitylocation not on record	2
Palmerston, AU	2
Moscow State Universitylocation not on record	1
Chicago, US	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Rotorua, NZ	1
University of Stellenboschlocation not on record	1

21 institutions · 381 of 385 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pteris umbrosa

At a glance

Sources6 archives

Size & morphology5

Life cycle & reproduction4

Diet & foraging1

Habitat & environment7

Physiology & chemistry2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 599 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions15 of 21 geolocated

Cultivated / Captivenot free-living

Record type1 599 records