Pteris multifida
Poir. · speciesAt a glance
Occurrence records6 935
Data sources10
Biological traits25
DNA specimens4
eDNA detections4
Sources10 archives
Databases and archives Pteris multifida's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility6 935 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics4 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources25 traits
Chemical compositionLOTUS · NPASS113 compounds
Occurrence & distributionGBIF6 935 records
Environmental DNA1 datasets · 1 countries4 detections
DNA & barcodingBOLD · NCBI4 specimens
Genome at a glanceCCDB2n = 116
01Narrative
イノモトソウは、シダ植物門イノモトソウ科イノモトソウ亜科イノモトソウ属の植物で、やや小型のシダ植物である。
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology4
Leaf length95 mm
Leaf width4.5 mm
Leaf width max250 mm
Leaf width min130 mm
Life cycle & reproduction5
Flowering endAug
Flowering startApr
Life formlithophyte
Life spanperennial
Raunkiær life formchamaephyte
Diet & foraging1
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max300 m
Elevation min0 m
Epiphyteterrestrial
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: fern · TRY: Herb
Habitat GIFTFloresta Ombrófila (= Floresta Pluvial)
Leaf compoundnesscompound
Leaf formlinear
Leaf shapelanceolate linear
Woodinessnon-woody
Physiology & chemistry1
Leaf p3.08 mg/g
Other traits2
Shoot length max35 cm
Shoot length min10 cm
03Chemical composition113 compounds
Compounds documented for Pteris multifida across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Illudalane sesquiterpenoids32
Kaurane and Phyllocladane diterpenoids16
Flavones6
Kaurane and Phyllocladane diterpenoids $ Norkaurane diterpenoids6
Cinnamic acids and derivatives5
Documented compounds113 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R)-4-[(1E,3E,5E,7E,9E,11E,13E,15E,17E)-18-[(4R)-4-hydroxy-2,6,6-trimethylcyclohex-2-en-1-yl]-3,7,12,16-tetramethyloctadeca-1,3,5,7,9,11,13,15,17-nonaenyl]-3,5,5-trimethylcyclohex-3-en-1-ol | present | NPASS | |
| (1R,13R)-7,7-Dimethyl-8,12,20-trioxapentacyclo[11.8.0.02,11.04,9.014,19]henicosa-2(11),3,5,9,14(19),15,17-heptaen-17-ol | present | LOTUS | |
| (1R,3R,4R,7R,9S,10R,13R,14R)-14-(hydroxymethyl)-5,5,9-trimethyltetracyclo[11.2.1.01,10.04,9]hexadecane-3,7,14-triol | present | LOTUS | |
| (1R,3R,4R,7R,9S,10R,13R,14S)-5,5,9,14-tetramethyltetracyclo[11.2.1.01,10.04,9]hexadecane-3,7-diol | present | LOTUS | |
| (1R,4R,7R,9R,10S,13R,15S)-5,5,9,14,14-pentamethyltetracyclo[11.2.1.01,10.04,9]hexadecane-7,15-diol | present | LOTUS | |
| (1R,4S,5S,7S,9R,10S,13R,15S)-5-(hydroxymethyl)-5,9-dimethyl-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecane-7,15-diol | present | LOTUS | |
| (1S,2R,10S,11R)-6,15-bis[(1R)-1,2-dihydroxyethyl]-5,7,10,11,14,16-hexamethylpentacyclo[9.7.0.02,10.03,8.013,18]octadeca-3(8),4,6,13(18),14,16-hexaene-9,12-dione | present | LOTUS | |
| (1S,2S,10R,11R)-6,15-bis[(1R)-1,2-dihydroxyethyl]-5,7,10,11,14,16-hexamethylpentacyclo[9.7.0.02,10.03,8.013,18]octadeca-3(8),4,6,13(18),14,16-hexaene-9,12-dione | present | LOTUS | |
| (1S,4R,7R,9R,10R,13R,14R)-14-(hydroxymethyl)-5,5,9-trimethyltetracyclo[11.2.1.01,10.04,9]hexadecane-7,14-diol | present | LOTUS | |
| (1S,4R,7R,9R,10S,13S,15S,16R)-5,5,9-trimethyl-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecane-7,15,16-triol | present | LOTUS |
05DNA & barcoding4 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pteris multifida has left across the world's sequence archives.
At a glance
DNA specimens4
Marker genes2
GenBank sequences10
eDNA detections4
Countries4
The DNA barcodea real sequence read deposited for this species
AAGCTGGTGTCAAAGATTACCGATTGACTTATTACACTCCCGAATACAAGACCAAAGATACTGATATCTTAGCGGCTTTCCGAATGACCC …
Pteris multifida voucher TAIF:Kuo4215 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL7
plant barcode
06Genome at a glanceCCDB
The complete instruction manual Pteris multifida carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 116 n = 58
Chromosome records58–1162n range116median116mode15records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 11613×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-LoveLove1977 +2
CCDB · book-ipcn65 — Roy & H. 1965b
CCDB · ipcn-api-dl — Kawakami, S. M., M. Ito & S. Kawakami. 1995. Apogamous sporophyte formation in a fern Pteris multifida and its characteristics. J. Pl. Res. 108: 181–184.
CCDB · ipcn-api-dl — Nakato, N. 1975. A cytological study on an intermediate form between Pteris multifida and P. cretica. J. Jap. Bot. 50: 23–29.
CCDB · book-LoveLove1977 — Schifferdecker 1957
CCDB · book-LoveLove1977 — Mehra & Verma 1960
CCDB · book-LoveLove1977 — Abraham, Ninan & Mathew 1962
CCDB · book-LoveLove1977 — Walker, T. G. 1962a
CCDB · book-LoveLove1977 — Ghatak 1963
CCDB · book-LoveLove1977 — Mitui 1965
CCDB · book-LoveLove1977 — Roy, S. K. & Holttum 1965b
CCDB · book-LoveLove1977 — Mitui 1968
CCDB · eflora
CCDB · Cave1962 — T. G. Walker 1962a
2n 582×CCDB · book-LoveLove1977
CCDB · book-LoveLove1977 — Schifferdecker 1957
CCDB · book-LoveLove1977 — Walker, T. G. 1962a
2n 871×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Chang, Y. j., W. C. Shieh & J. l. Tsai. 1992. Studies on the karyotypes of the fern genus Pteris in Taiwan. Pp. 93–109 <in> J.–l. Tsai & W.–c. Shieh (editors), Proceedings of the Second Seminar on Asian Pteridology Taiwan 17–22 March 1992. National Chung Hsing University and National Science Council.
n 587×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +3
CCDB · book-ipcn65 — Mitui 1965
CCDB · ipcn-api-dl — Weng, R. f. & S. p. Qiu. 1988. Chromosome counts of some ferns from Zhejiang. Invest. Stud. Nat. 8: 43–52.
CCDB · ipcn-api-dl — Nakato, N. 1975. A cytological study on an intermediate form between Pteris multifida and P. cretica. J. Jap. Bot. 50: 23–29.
CCDB · book-ipcn67-71 — MITUI, K. 1968. Chromosomes and speciation in ferns. Sci. Rep. Tokyo Kyoiku Daigaku Sect. B 13: 285-333.
CCDB · Cave1957 — Schifferdeoker
CCDB · Cave1962
CCDB · Cave1963 — Ghatak 1962
08Occurrence & distribution
Record type6 935 records
Wild obs. + sensor2 430
Museum / vouchered4 470
Cultivated / captive2
Other33
Origin
Native15
Introduced22
Range
Area of Occupancy AOO17 560 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy90% within 1 km
≤100 m 979≤1 km 183≤10 km 77>10 km 59
1 298 georeferenced · 1 132 without coordinates
Open the mapobservation + sensor2 430
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy39% within 1 km
≤100 m 21≤1 km 66≤10 km 112>10 km 23
222 georeferenced · 4 248 without coordinates
Open the institutions mapphysical evidence4 470
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 2 records without
Open the mapnot free-living2
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions110 of 191 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Tsukuba, JP | 1 933 |
| Odawara, JP | 253 |
| Beijing, CN | 242 |
| Nanjing, CN | 163 |
| Sanda, JP | 139 |
| Osaka, JP | 118 |
| Kawasaki Shi Tama Ku, JP | 114 |
| Kochi, JP | 92 |
| Toyama, JP | 50 |
| Nagano City, JP | 49 |
| Chapel Hill, US | 46 |
| Wuhan, CN | 44 |
| Guangzhou, CN | 44 |
| Sendai, JP | 41 |
| Bando, JP | 41 |
| Guilin, CN | 38 |
| Yangling, CN | 37 |
| Chiba, JP | 36 |
| KURAlocation not on record | 35 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 33 |
| Shinshu Universitylocation not on record | 32 |
| South Kensington, GB | 31 |
| Taipei, TW | 31 |
| NSMKlocation not on record | 30 |
| Jiangxi Universitylocation not on record | 26 |
| Tomioka, JP | 25 |
| Xinxiang, CN | 24 |
| Yunnan Universitylocation not on record | 23 |
| Nishihara, JP | 22 |
| Bronx, US | 21 |
| Hangzhou, CN | 18 |
| Chengdu, CN | 18 |
| Fort Worth, US | 16 |
| Zhengzhou, CN | 15 |
| National Institute of Biological Resourceslocation not on record | 15 |
| TAIElocation not on record | 15 |
| Saint Louis, US | 15 |
| Xian, CN | 14 |
| Central China Normal Universitylocation not on record | 14 |
| BIO-UNIPIlocation not on record | 14 |
| Sagamihara, JP | 13 |
| Guiyang, CN | 13 |
| Philadelphia, US | 12 |
| Chicago, US | 12 |
| Knoxville, US | 11 |
| Wuhan, CN | 11 |
| LDlocation not on record | 11 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 10 |
| Paris, FR | 10 |
| Nanchong, CN | 10 |
| Tuscaloosa, US | 10 |
| Shanghai, CN | 10 |
| Tokushima, JP | 10 |
| Seoul, KR | 10 |
| KR | 10 |
| JP | 8 |
| Museo Entomologico de Leonlocation not on record | 8 |
| Mississippi State, US | 8 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 7 |
| Jackson, US | 6 |
| Auckland, NZ | 6 |
| Shanghai, CN | 6 |
| Clemson, US | 6 |
| University of Stellenboschlocation not on record | 5 |
| McWane Science Centerlocation not on record | 5 |
| Fullerton, US | 5 |
| Burlington, US | 5 |
| Jishou Universitylocation not on record | 5 |
| Ischia Marine Centrelocation not on record | 5 |
| Museu Paraense Emílio Goeldilocation not on record | 5 |
| Columbia, US | 5 |
| US | 5 |
| Fukushima Universitylocation not on record | 5 |
| Durham, US | 4 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 4 |
| 黔东南州民族医药研究所标本室location not on record | 4 |
| Xiangtan City, CN | 4 |
| Tianjin Natural History Museumlocation not on record | 4 |
| Jiujiang Forestry Institutelocation not on record | 4 |
| Xiamen, CN | 4 |
| Beijing Normal Universitylocation not on record | 4 |
| Inner Mongolia Universitylocation not on record | 4 |
| J.F.Oberlin Universitylocation not on record | 4 |
| JBRJlocation not on record | 4 |
| Chongqing Museumlocation not on record | 4 |
| Tampa, US | 4 |
| Salvador, BR | 4 |
| Miami, US | 3 |
| Ann Arbor, US | 3 |
| WNNUlocation not on record | 3 |
| Morgantown, US | 3 |
| Taipei, TW | 3 |
| Parthenon Tama History Museumlocation not on record | 3 |
| Nishihara, JP | 3 |
| MeiseBGlocation not on record | 3 |
| Jena Microbial Resource Collectionlocation not on record | 3 |
| DNSMlocation not on record | 3 |
| Akita Prefectural Museumlocation not on record | 3 |
| Kyoto Universitylocation not on record | 3 |
| Mount Annan, AU | 3 |
| Valparaiso, CL | 3 |
| AUAlocation not on record | 3 |
| SCAUlocation not on record | 3 |
| Instituto de Ecología y Sistemáticalocation not on record | 3 |
| Awka, NG | 2 |
| Riverside, US | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| BAYLUlocation not on record | 2 |
| Corvallis, US | 2 |
| Canberra, AU | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| Anhui Normal Universitylocation not on record | 2 |
| Adelaide, AU | 2 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 2 |
| Zhuzhou, CN | 2 |
| Zhejiang Universitylocation not on record | 2 |
| KIRMlocation not on record | 2 |
| Bloomington, US | 2 |
| Elocation not on record | 2 |
| UFBAlocation not on record | 2 |
| GAlocation not on record | 2 |
| Bangkok, TH | 2 |
| Vancouver, CA | 2 |
| Guiyang, CN | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| Otaru, JP | 2 |
| KNAMlocation not on record | 2 |
| St. Augustine, TT | 2 |
| Kew, GB | 2 |
| Guiyang, CN | 2 |
| WTUlocation not on record | 2 |
| Madison, US | 2 |
| Toyota city nature sanctuarylocation not on record | 2 |
| Chicago, US | 1 |
| Edinburgh, GB | 1 |
| Tilburg, NL | 1 |
| Guiyang, CN | 1 |
| KOMlocation not on record | 1 |
| Pittsburg, US | 1 |
| Oiso Municipal Museumlocation not on record | 1 |
| Little Rock, US | 1 |
| GMBAlocation not on record | 1 |
| Montréal, CA | 1 |
| ESALQlocation not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Ilhéus, BR | 1 |
| Williamsburg, US | 1 |
| Pullman, US | 1 |
| BClocation not on record | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| Los Angeles, US | 1 |
| Shenzhen, CN | 1 |
| 重庆市药物种植研究所药用植物标本馆location not on record | 1 |
| CEPLAClocation not on record | 1 |
| Chongqing Natural History Museumlocation not on record | 1 |
| Claremont, US | 1 |
| Western Carolina Universitylocation not on record | 1 |
| Hobart, AU | 1 |
| CASlocation not on record | 1 |
| University of Southern Mississippilocation not on record | 1 |
| Conway, US | 1 |
| Kunming, CN | 1 |
| Chengdu, CN | 1 |
| Muzaffarabad, PK | 1 |
| Kagoshima, JP | 1 |
| Wellington, NZ | 1 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Brasília, BR | 1 |
| Uppsala, SE | 1 |
| Obihiro Centennial City Museumlocation not on record | 1 |
| Millersville, US | 1 |
| University of South Carolina Salkehatchielocation not on record | 1 |
| Chengdu, CN | 1 |
| Palmerston, AU | 1 |
| Due West, US | 1 |
| College Park, US | 1 |
| GZUlocation not on record | 1 |
| PRClocation not on record | 1 |
| BSBIlocation not on record | 1 |
| ENHMlocation not on record | 1 |
| Texas A&M Universitylocation not on record | 1 |
| Guangzhou, CN | 1 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 1 |
| Stockholm, SE | 1 |
| UFMGlocation not on record | 1 |
| UFPElocation not on record | 1 |
| Austin, US | 1 |
| Departamento de Sistematica e Ecologialocation not on record | 1 |
| Central China Agricultural Universitylocation not on record | 1 |
191 institutions · 4 458 of 4 470 vouchered records shown · 11 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA4 detections
Where the DNA of Pteris multifida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found4
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 4 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median7.40 °C 7.40–7.40
Seasonal swing summer↔winter25.4 °C
Max temp (day)9.60 °C
Min temp (night)3.00 °C
Precipitation344 mm/mo
Air humidity64.9 %
Moisture balance263 mm/mo
Vapour deficit428 Pa
Wind speed2.90 m/s
Cloud cover44.6 %
CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.