Pteris cretica
speciesAt a glance
Occurrence records10 150
Data sources12
Biological traits22
DNA specimens28
eDNA detections25
Sources12 archives
Databases and archives Pteris cretica's data was compiled from.
WikipediaWikimedia Foundation11 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility10 150 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics28 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources22 traits
Chemical compositionLOTUS · NPASS135 compounds
Occurrence & distributionGBIF10 150 records
Environmental DNA1 datasets · 3 countries25 detections
DNA & barcodingBOLD · NCBI28 specimens
Genome at a glanceCCDB2n = 58
01Narrative
Pteris cretica 'Albolineata'. Vegetative leaves and sporophylls (upper, linear). Pteris cretica, the Cretan brake, ribbon fern, or Cretan brake fern, is a species of evergreen fern in the family Pteridaceae, native to Europe, Asia and Africa.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology2
Plant height max0.8 m
Plant height min0.25 m
Life cycle & reproduction5
Flowering endAug
Flowering startApr
Life formrhizomatous geophyte or lithophyte
Life spanperennial
Lifeform raunkiaer detailedgeophyte
Diet & foraging1
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatesubtropical
Climberself-supporting
Elevation max3 000 m
Elevation min0 m
Epiphyteterrestrial
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: fern · TRY: Herb
Habitat GIFTFloresta Ombrófila (= Floresta Pluvial)
Leaf compoundnesscompound
Leaf formpinnate
Leaf shapeoblong
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry1
Photosynthetic pathwayC3
03Chemical composition135 compounds
Compounds documented for Pteris cretica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Illudalane sesquiterpenoids13
Flavones9
Proanthocyanins7
Kaurane and Phyllocladane diterpenoids6
Flavan-3-ols5
Documented compounds135 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-taxifolin | present | NPASS | |
| (2R,2'R,3S,3'S,4S)-2'-(3,4-Dihydroxyphenyl)-3,3',4,4'-tetrahydro-2-(3,4,5-trihydroxyphenyl)(4,8'-bi-2H-1-benzopyran)-3,3',5',7,7'-pentol | present | NPASS | |
| (2R,3aR,7S)-7-hydroxy-2,5,7-trimethyl-3a-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyspiro[3,7a-dihydro-2H-indene-6,1'-cyclopropane]-1-one | present | NPASS | |
| (2R,3R)-3-hydroxy-6-(2-hydroxyethyl)-2-(hydroxymethyl)-2,5,7-trimethyl-3H-inden-1-one | present | NPASS | |
| (2R,3S)-2-(3,4-dihydroxyphenyl)-8-[(2R,3S,4R)-3,7-dihydroxy-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromen-4-yl]-3,4-dihydro-2H-chromene-3,5,7-triol | present | NPASS | |
| (2R,3S)-8-[(2R,3S,4R)-3,7-dihydroxy-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromen-4-yl]-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromene-3,5,7-triol | present | NPASS | |
| (2R,3S,4R)-2-(3,4-dihydroxyphenyl)-6-[(2R,3S,4S)-2-(3,4-dihydroxyphenyl)-3,7-dihydroxy-3,4-dihydro-2H-chromen-4-yl]-3,4-dihydro-2H-chromene-3,4,7-triol | present | NPASS | |
| (2R,3S,4S)-2-(3,4-dihydroxyphenyl)-6-[(2R,3S,4S)-2-(3,4-dihydroxyphenyl)-3,7-dihydroxy-3,4-dihydro-2H-chromen-4-yl]-3,4-dihydro-2H-chromene-3,4,7-triol | present | NPASS | |
| (2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[[(1R,4R,7R,9R,10S,13R,15S)-15-hydroxy-5,5,9-trimethyl-14-methylidene-7-tetracyclo[11.2.1.01,10.04,9]hexadecanyl]oxy]oxane-3,4,5-triol | present | NPASS | |
| (2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[[(1S,4R,7R,9R,10R,13R,14R)-14-hydroxy-5,5,9,14-tetramethyl-7-tetracyclo[11.2.1.01,10.04,9]hexadecanyl]oxy]oxane-3,4,5-triol | present | NPASS |
05DNA & barcoding28 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pteris cretica has left across the world's sequence archives.
At a glance
DNA specimens28
Marker genes3
GenBank sequences10
eDNA detections25
Countries3
The DNA barcodea real sequence read deposited for this species
ACTCCCGAATACAAGACCAAAGATACTGATATCTTAGCGGCTTTCCGAATGACCCCACAACCTGGAGTACCGGCTGAGGAGGCCGGAGCT …
Pteris cretica isolate SW26 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL8★rbcLa
plant barcode
06Genome at a glanceCCDB
The complete instruction manual Pteris cretica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 58 n = 29
Chromosome records58–2322n range58median58mode23records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 5817×CCDB · fl-europaea · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +3
CCDB · fl-europaea — Manton, 1950
CCDB · ipcn-api-dl — Vasudeva, S. M. & S. S. Bir. 1983. Chromosome numbers and evolutionary status of ferns and fern allies of Pachmarhi Hills (Central India).In: S. S. Bir (editor), Pteridophytes: their morphology, cytology, taxonomy and phylogeny. Aspects Pl. Sci. 6: 119–181.
CCDB · ipcn-api-dl — Khullar, S. P., S. S. Sharma & S. C. Verma. 1988. SOCGI plant chromosome number reports -- VI. J. Cytol. Genet. 23: 38–52.
CCDB · ipcn-api-dl — Takei, M. 1991. . . . Pteris cretica . . . Pl. Tissue Cult. Lett. 8: 179–184.
CCDB · ipcn-api-dl — Chang, Y. j., W. C. Shieh & J. l. Tsai. 1992. Studies on the karyotypes of the fern genus Pteris in Taiwan. Pp. 93–109 <in> J.–l. Tsai & W.–c. Shieh (editors), Proceedings of the Second Seminar on Asian Pteridology Taiwan 17–22 March 1992. National Chung Hsing University and National Science Council.
CCDB · ipcn-api-dl — Lin, S., K. Iwatsuki & M. Kato. 1996. Cytotaxonomic study of ferns from China, I. Species of Yunnan. J. Jap. Bot. 71: 214–222.
CCDB · ipcn-api-dl — Nakato, N. 1975. A cytological study on an intermediate form between Pteris multifida and P. cretica. J. Jap. Bot. 50: 23–29.
CCDB · book-ipcn67-71 — ROY, R.P., B.M.B. SINHA, & A.R. SAKYA. 1971. Cytology of some ferns of Kathmandu valley. Brit. Fern Gaz. 10: 193-199.
CCDB · book-LoveLove1977 — Manton 1950
CCDB · book-LoveLove1977 — Verma 1959
CCDB · book-LoveLove1977 — Mehra & Verma 1960
CCDB · book-LoveLove1977 — Verma & Loyal 1960a
CCDB · book-LoveLove1977 — Walker, T. G. 1960
CCDB · book-LoveLove1977 — Verma (in Mehra 1961b)
CCDB · book-LoveLove1977 — Roy, R. P., Sinha & Sakya 1971
CCDB · Cave1962 — T. G. Walker 1962a
CCDB · iapt — IAPT/IOPB Chromosome Data 30
2n 8713×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1
CCDB · book-ipcn65 — Holttum & R. 1965
CCDB · ipcn-api-dl — Bir, S. S. 1996. Cytology of some ferns from the Nilgiris, south India III. Brit. Fern Gaz. 15: 141–149.
CCDB · book-ipcn67-71 — VERMA, S. C., & M. GOLOKNATH. 1967. In IOPB chromosome number reports X. Taxon 16: 146-157.
CCDB · book-LoveLove1977 — Schifferdecker 1957
CCDB · book-LoveLove1977 — Walker, T. G. 1962a
CCDB · book-LoveLove1977 — Ghatak 1963
CCDB · book-LoveLove1977 — Roy, R. P. & Pandey 1963a
CCDB · book-LoveLove1977 — Holttum & Roy, S. K. 1965
CCDB · book-LoveLove1977 — Mitui 1965
CCDB · book-LoveLove1977 — Mitui (in Fabbri 1965)
CCDB · book-LoveLove1977 — Kurita 1966b
CCDB · book-LoveLove1977 — Verma & Goloknath (in Love 1967b)
CCDB · book-LoveLove1977 — Mitui 1968
2n 1163×CCDB · ipcn-api-dl · CCDB · book-LoveLove1977
CCDB · ipcn-api-dl — Chang, Y. j., W. C. Shieh & J. l. Tsai. 1992. Studies on the karyotypes of the fern genus Pteris in Taiwan. Pp. 93–109 <in> J.–l. Tsai & W.–c. Shieh (editors), Proceedings of the Second Seminar on Asian Pteridology Taiwan 17–22 March 1992. National Chung Hsing University and National Science Council.
CCDB · book-LoveLove1977 — Roy, R. P. & Pandey 1962
CCDB · book-LoveLove1977 — Walker, T. G. 1962a
2n 531×CCDB · book-LoveLove1977
CCDB · book-LoveLove1977 — Walker, T. G. 1962a
2n 901×CCDB · book-LoveLove1977
CCDB · book-LoveLove1977 — Vazart 1956
2n 1741×CCDB · book-LoveLove1977
CCDB · book-LoveLove1977 — Schifferdecker 1957
2n 2321×CCDB · book-LoveLove1977
CCDB · book-LoveLove1977 — Schifferdecker 1957
n 879×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71
CCDB · book-ipcn65 — Mitui 1965
CCDB · ipcn-api-dl — Khare, P. B. & S. Kaur. 1983. Cytological observations of ferns grown in NBRI - I. New Bot. 10: 115–116.
CCDB · ipcn-api-dl — Raj, V. I. & V. S. Manickam. 1987. SOCGI plant chromosome number reports -- IV [i.e., V]. J. Cytol. Genet. 22: 156–161.
CCDB · ipcn-api-dl — Manickam, V. S. & V. Irudayaraj. 1988. Cytology of Ferns of the Western Ghats (South India). 81 pp.
CCDB · ipcn-api-dl — Punetha, N. 1989. Cytological observations on ferns of Kumaon (N. W. Himalaya). Aspects Pl. Sci. 11: 459–465.
CCDB · ipcn-api-dl — Bir, S. S. 1996. Cytology of some ferns from the Nilgiris, south India III. Brit. Fern Gaz. 15: 141–149.
CCDB · ipcn-api-dl — Rajkumar, S. D. 2001. IOPB chromosome data 17. Newslett. Int. Organ. Pl. Biosyst. (Pruhonice) 33: 25–26.
CCDB · book-ipcn67-71 — MITUI, K. 1968. Chromosomes and speciation in ferns. Sci. Rep. Tokyo Kyoiku Daigaku Sect. B 13: 285-333.
CCDB · book-ipcn67-71 — VERMA, S. C., & M. GOLOKNATH. 1967. In IOPB chromosome number reports X. Taxon 16: 146-157.
n 291×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — ROY, R.P., B.M.B. SINHA, & A.R. SAKYA. 1971. Cytology of some ferns of Kathmandu valley. Brit. Fern Gaz. 10: 193-199.
n 581×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Punetha, N. 1989. Cytological observations on ferns of Kumaon (N. W. Himalaya). Aspects Pl. Sci. 11: 459–465.
07Deep time~0.13 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin0.13 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type10 150 records
Wild obs. + sensor3 608
Museum / vouchered6 515
Cultivated / captive9
Other18
Origin
Native39
Introduced234
Range
Area of Occupancy AOO20 872 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy61% within 1 km
≤100 m 1 277≤1 km 493≤10 km 1 016>10 km 108
2 894 georeferenced · 714 without coordinates
Open the mapobservation + sensor3 608
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy49% within 1 km
≤100 m 316≤1 km 131≤10 km 429>10 km 36
912 georeferenced · 5 603 without coordinates
Open the institutions mapphysical evidence6 515
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 9 records without
Open the mapnot free-living9
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions144 of 234 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Tsukuba, JP | 2 385 |
| Odawara, JP | 397 |
| Sanda, JP | 234 |
| Osaka, JP | 167 |
| Durango, MX | 167 |
| Bando, JP | 121 |
| Pretoria, ZA | 116 |
| Toyama, JP | 109 |
| Kochi, JP | 102 |
| Saint Louis, US | 96 |
| Chicago, US | 91 |
| Zürich, CH | 84 |
| Nagano City, JP | 80 |
| Paris, FR | 76 |
| Wuhan, CN | 71 |
| BIO-UNIPIlocation not on record | 66 |
| Kawasaki Shi Tama Ku, JP | 62 |
| Bern, CH | 60 |
| CJBGlocation not on record | 59 |
| Wellington, NZ | 58 |
| Tomioka, JP | 57 |
| Taipei, TW | 55 |
| Cape Town, ZA | 55 |
| Shinshu Universitylocation not on record | 54 |
| Sendai, JP | 53 |
| LDlocation not on record | 50 |
| South Kensington, GB | 48 |
| Auckland, NZ | 46 |
| Mexico City, MX | 46 |
| Zürich, CH | 44 |
| Kew, GB | 43 |
| Chiba, JP | 43 |
| Moscow State Universitylocation not on record | 43 |
| KURAlocation not on record | 41 |
| MeiseBGlocation not on record | 39 |
| Austin, US | 36 |
| Beijing, CN | 33 |
| TAIElocation not on record | 32 |
| Christchurch, NZ | 32 |
| University of Stellenboschlocation not on record | 26 |
| Bronx, US | 25 |
| Sagamihara, JP | 24 |
| Lausanne, CH | 20 |
| Austin, US | 20 |
| Durban, ZA | 18 |
| Philadelphia, US | 18 |
| Nishihara, JP | 16 |
| KOMlocation not on record | 15 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 15 |
| Guasave, MX | 15 |
| Tampa, US | 13 |
| CASlocation not on record | 13 |
| Mexico City, MX | 13 |
| Taipei, TW | 13 |
| Madison, US | 13 |
| BISHlocation not on record | 12 |
| Adam Mickiewicz University in Poznańlocation not on record | 12 |
| Juriquilla, MX | 11 |
| Universität Basel, Herbariumlocation not on record | 11 |
| Chongqing Museumlocation not on record | 11 |
| Guatemala City, GT | 11 |
| Burlington, US | 11 |
| National Institute of Biological Resourceslocation not on record | 11 |
| WTUlocation not on record | 11 |
| National Museums of Kenyalocation not on record | 10 |
| Guiyang, CN | 10 |
| KR | 10 |
| Giardini Botanici Hanburylocation not on record | 9 |
| Ann Arbor, US | 9 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 9 |
| Edinburgh, GB | 9 |
| Fort Worth, US | 9 |
| Ciudad de México, MX | 9 |
| Chapel Hill, US | 9 |
| Santa Barbara, US | 9 |
| San Isidro, AR | 9 |
| Parthenon Tama History Museumlocation not on record | 8 |
| J.F.Oberlin Universitylocation not on record | 8 |
| Riverside, US | 8 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 8 |
| Wuhan, CN | 8 |
| Toyota city nature sanctuarylocation not on record | 8 |
| Toluca, MX | 8 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 8 |
| ASUlocation not on record | 8 |
| Miami, US | 7 |
| JP | 7 |
| McWane Science Centerlocation not on record | 7 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 7 |
| Bloomington, US | 7 |
| National Museums of Kenyalocation not on record | 6 |
| BClocation not on record | 6 |
| TAFORI-LSRClocation not on record | 6 |
| Ciudad de México, MX | 6 |
| UNINE:NEUlocation not on record | 6 |
| Akita Prefectural Museumlocation not on record | 6 |
| Tokushima, JP | 6 |
| GMBAlocation not on record | 6 |
| Santarém, BR | 6 |
| Nanchong, CN | 5 |
| Minia, EG | 5 |
| Henry Brockhouse Collectionlocation not on record | 5 |
| MEXUlocation not on record | 5 |
| 湖北神农架林区标本馆location not on record | 5 |
| Cape Town, ZA | 5 |
| Salvador, BR | 5 |
| Claremont, US | 5 |
| Autlán de Navarro, MX | 5 |
| Fukushima Universitylocation not on record | 5 |
| Rotorua, NZ | 5 |
| Tapachula, MX | 5 |
| Wlocation not on record | 5 |
| Kunming, CN | 5 |
| Seoul, KR | 5 |
| Tuxtla Gutiérrez, MX | 4 |
| Tuxtla Gutiérrez, MX | 4 |
| Plocation not on record | 4 |
| Oiso Municipal Museumlocation not on record | 4 |
| Cambridge University Herbariumlocation not on record | 4 |
| Podgorica, ME | 4 |
| Stockholm, SE | 4 |
| Shanghai, CN | 4 |
| Muzaffarabad, PK | 4 |
| Hobart, AU | 4 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 4 |
| The University of Arizonalocation not on record | 3 |
| Santa Cruz, US | 3 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 3 |
| Universidad de Caldas (UCaldas)location not on record | 3 |
| Corrientes, AR | 3 |
| Corvallis, US | 3 |
| Canadian Department of Agriculturelocation not on record | 3 |
| LNBG$location not on record | 3 |
| Morgantown, US | 3 |
| UFBAlocation not on record | 3 |
| Berlin, DE | 3 |
| Elocation not on record | 3 |
| Honolulu, US | 3 |
| Kyoto Universitylocation not on record | 3 |
| Linares, MX | 3 |
| Tall Timbers Research Stationlocation not on record | 3 |
| Nishihara, JP | 3 |
| BDBClocation not on record | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| KIRMlocation not on record | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| Chicago, US | 2 |
| Antiguo Cuscatlán, SV | 2 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 2 |
| Xiamen, CN | 2 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 2 |
| Cambridge, US | 2 |
| Philadelphia, US | 2 |
| Dehra Dun, IN | 2 |
| Jena Microbial Resource Collectionlocation not on record | 2 |
| Guangzhou, CN | 2 |
| Mount Annan, AU | 2 |
| Blumenau, BR | 2 |
| Tlalnepantla, MX | 2 |
| Görlitz, DE | 2 |
| La Paz, MX | 2 |
| US | 2 |
| Durham, US | 2 |
| Bangkok, TH | 2 |
| Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record | 2 |
| Otaru, JP | 2 |
| BMlocation not on record | 2 |
| Yangling, CN | 2 |
| College of the Atlantic, Museumlocation not on record | 2 |
| Lake Charles, US | 2 |
| J. Rusek Collectionlocation not on record | 2 |
| West China Subalpine Botanical Gardenlocation not on record | 2 |
| Fortaleza, BR | 2 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 2 |
| Brisbane, AU | 1 |
| Tampere, FI | 1 |
| Campo Mourão, BR | 1 |
| JBSlocation not on record | 1 |
| Bourges, FR | 1 |
| Columbia, US | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| UFRRJlocation not on record | 1 |
| Davis, US | 1 |
| Flagstaff, US | 1 |
| College Park, US | 1 |
| UFPRlocation not on record | 1 |
| JBRJlocation not on record | 1 |
| Museo de Historia Natural Alfredo Dugés, Universidad de Guanajuatolocation not on record | 1 |
| Santa Teresa, BR | 1 |
| Seropédica, BR | 1 |
| Uppsala, SE | 1 |
| Seychelles National Herbariumlocation not on record | 1 |
| Córdoba, AR | 1 |
| València, ES | 1 |
| Pondicherry, IN | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| Phoenix, US | 1 |
| Fribourg, CH | 1 |
| Puebla, MX | 1 |
| INMAlocation not on record | 1 |
| Calabar, NG | 1 |
| Brussel, BE | 1 |
| Vancouver, CA | 1 |
| Universidad Nacional de Colombia (UNAL)location not on record | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
| Chicago, US | 1 |
| San Luis Obispo, US | 1 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 1 |
| St. Paul, US | 1 |
| Anchorage, US | 1 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| SCAUlocation not on record | 1 |
| Arusha, TZ | 1 |
| Durham, US | 1 |
| Chapingo, MX | 1 |
| Ishikawa Museum of Natural Historylocation not on record | 1 |
| UTFPR-CPlocation not on record | 1 |
| UTFPR-SLlocation not on record | 1 |
| BRNUlocation not on record | 1 |
| EAlocation not on record | 1 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 1 |
| Santiago de Compostela, ES | 1 |
| Salamanca, ES | 1 |
| Shanghai, CN | 1 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 1 |
| Provincia di Livornolocation not on record | 1 |
| Logan, US | 1 |
| Angwin, US | 1 |
| Museo Entomologico de Leonlocation not on record | 1 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 1 |
| San Luis Potosí, MX | 1 |
| Brookings, US | 1 |
| Dhaka, BD | 1 |
234 institutions · 6 399 of 6 515 vouchered records shown · 114 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA25 detections
Where the DNA of Pteris cretica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found25
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 25 detections have coordinates
Open the map3 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median8.00 °C 4.40–19.2
Seasonal swing summer↔winter3.90 °C
Max temp (day)10.5 °C 8.00–24.6
Min temp (night)4.70 °C 1.00–13.8
Precipitation177 mm/mo 121–232
Air humidity59.6 % 58.8–60.4
Moisture balance45.4 mm/mo 18.7–112
Vapour deficit474 Pa 343–881
Wind speed2.20 m/s 1.10–2.80
Cloud cover40.2 % 35.8–52.6
CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.