Pteris chilensis — The Life Data

Plantae/Tracheophyta/Polypodiopsida/Polypodiales/Pteridaceae/Pteris

At a glance

Occurrence records40

Data sources4

Biological traits9

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Pteris chilensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility40 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources9 traits

Occurrence & distributionGBIF40 records

DNA & barcodingNCBIsequences

01Narrative

ديشار تشيلي هو نوع نباتي يتبع جنس الديشار من فصيلة الديشارية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climberself-supporting

Elevation max1 400 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pteris chilensis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM008161.1 ↗1 286 bpChile

ACGT

GTGTCAGAGATTACCGATTGACTTATTACACTCCCGAATACAAGACCAAAGATACTGATATCTTAGCGGCTTTCCGCATGACCCCACAAC …

Pteris chilensis voucher Zollner 17416 (MO) ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL1

plant barcode

08Occurrence & distribution

Record type40 records

Wild obs. + sensor25

Museum / vouchered15

Range

Area of Occupancy AOO100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 8≤1 km 8≤10 km 3

19 georeferenced · 6 without coordinates

Open the mapobservation + sensor25

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 15 records without

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Valparaiso, CL	7
MAlocation not on record	2
LDlocation not on record	2
Herbario Universidad de Concepciónlocation not on record	1
Santiago de Compostela, ES	1
Edinburgh, GB	1
Uppsala, SE	1

7 institutions · 15 of 15 vouchered records shown