Ptereleotris hanae

(Jordan & Snyder, 1901) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Microdesmidae/Ptereleotris

At a glance

Occurrence records254

Data sources9

Biological traits7

DNA specimens4

eDNA detections0

Sources9 archives

Databases and archives Ptereleotris hanae's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility195 records↗

OBISOcean Biodiversity Information System59 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS254 records

DNA & barcodingBOLD4 specimens

01Narrative

Ptereleotris hanae, commonly known as the blue gudgeon dartfish or blue hana goby, is a species of dartfish native to the western Pacific Ocean. It is a reef inhabitant, being found at depths of from 3 to, though usually no shallower than 6 m. It inhabits burrows made by alpheid shrimp, but unlike the Amblyeleotris gobies who normally associate with these shrimp, this species has no interactions with their shrimp hosts. This species can reach a length of 12 cm TL. It can also be found in the aquarium trade.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length12 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max50 m

Depth min3 m

Vulnerability10

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ptereleotris hanae has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P660 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.91%

Haplotypes2

BIN1

Most divergent pair0.61%

Where individuals differ — all 10 variable positions, in barcode order

12Tvariable

13Tvariable

14Tvariable

18Avariable

63Tvariable

102Gmostly conserved

168Gmostly conserved

264Amostly conserved

318Amostly conserved

345Avariable

GGCACCCTTTATTTAGTATTTGGTGCTTGAGCCGGCATAGTGGGCACCGCCTTAAGCCTACTTATCCGAGCTGAATTAAGCCAGCCCGGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ptereleotris melanopogonsame genus2.6%Ptereleotris zebrasame genus12.3%Ptereleotris microlepissame genus12.4%Ptereleotris brachypterasame genus12.6%Ptereleotris evidessame genus13.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type254 records

Wild obs. + sensor145

Museum / vouchered107

Other2

Range

Area of Occupancy AOO532 km²

Depth

0–200 m sunlit20

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 12.5 m · max 52 m · 20 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 22≤1 km 23≤10 km 12>10 km 6

63 georeferenced · 82 without coordinates

Open the mapobservation + sensor145

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 12≤1 km 8≤10 km 1>10 km 11

32 georeferenced · 75 without coordinates

Open the institutions mapphysical evidence107

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Fisheries Research Laboratory, Mie Universitylocation not on record	22
Kagoshima University Museumlocation not on record	18
Honolulu, US	8
Toronto, CA	5
Western Australian Museumlocation not on record	5
Cincinnati, US	3
Museum and Art Gallery of the Northern Territorylocation not on record	3
National Marine Biodiversity Institute of Korealocation not on record	2
Australian National Fish Collectionlocation not on record	2
Paris, FR	1
Museums Victorialocation not on record	1
Washington, US	1
Ann Arbor, US	1
Sydney, AU	1

14 institutions · 73 of 107 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)