Pteranthus dichotomus

Forssk. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Caryophyllaceae/Pteranthus

At a glance

Occurrence records1 675

Data sources7

Biological traits28

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Pteranthus dichotomus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 675 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Occurrence & distributionGBIF1 675 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 32

01Narrative

Pteranthus is a monotypic genus of flowering plants belonging to the family Caryophyllaceae. The only species is Pteranthus dichotomus. Its native range is Canary Islands, Mediterranean to Pakistan and Arabian Peninsula.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Leaf length max20 mm

Leaf width max1.5 mm

Plant height max0.1 m

Plant height min0.05 m

Seed mass0.924 mg

Life cycle & reproduction8

Dispersal typeunspecialized

Flower length max5 mm

Flower length min4 mm

Flowering endJun

Flowering startApr

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max400 m

Elevation min100 m

Growth formherb

Habitat GIFTsemidesert

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits5

Leaf arrangementopposite

Plant support typefree-standing

Shoot length max15 cm

Shoot length min5 cm

Shoot orientationascending

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pteranthus dichotomus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY936250.1 ↗474 bp

ACGT

CCCATGCGTGGGAGACGGGGCGTTGGTTGGCTCCCTTGGGGGCCTGCCCTCTCCTCTCCCAAGCCGGGGGATCCCCCCCTCGTGGGGAGA …

Pteranthus dichotomus internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pteranthus dichotomus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidypolyploid inferred

Chromosome records32–322n range32median32mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 322×CCDB · ipcn-api-dl · CCDB · book-fedorov

CCDB · ipcn-api-dl — Díaz Lifante, Z., T. Luque & C. S. Bárbara. 1992. Chromosome numbers of plants collected during Iter Mediterraneum II in Israel. Bocconea 3: 229–250.

CCDB · book-fedorov — Reese

n 162×CCDB · iber-fl · CCDB · ipcn-api-dl

CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 664-690. Ruz de Clavijo Jimnez, E.Lagascalia17(1): 161-172(1993).

CCDB · ipcn-api-dl — Ruíz de Clavijo, E. 1993. Números cromosomáticos para la flora Española 664--690. Lagascalia 17: 161–172.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 675 records

Wild obs. + sensor1 600

Museum / vouchered72

Other3

Range

Area of Occupancy AOO3 500 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy56% within 1 km

≤100 m 215≤1 km 20≤10 km 175>10 km 8

418 georeferenced · 1 182 without coordinates

Open the mapobservation + sensor1 600

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 4≤1 km 7≤10 km 7>10 km 2

20 georeferenced · 52 without coordinates

Open the institutions mapphysical evidence72

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MAlocation not on record	13
BClocation not on record	13
Wlocation not on record	7
Moscow State Universitylocation not on record	4
Phyletisches Museum Jenalocation not on record	4
València, ES	4
Bratislava, SK	3
Salamanca, ES	2
QAUlocation not on record	2
Frankfurt am Main	2
Alicante, ES	1
Universidad del Pais Vasco (UPV/EHU)location not on record	1
Rishon Le Zion, IL	1
Kew, GB	1
Bronx, US	1
Phoenix, US	1
Paris, FR	1
Saint Louis, US	1
MeiseBGlocation not on record	1
LDlocation not on record	1
Granada, ES	1

21 institutions · 65 of 72 vouchered records shown · 7 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pteranthus dichotomus

At a glance

Sources7 archives

Size & morphology5

Life cycle & reproduction8

Diet & foraging1

Habitat & environment8

Physiology & chemistry1

Other traits5

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 675 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 21 geolocated

Record type1 675 records