Ptelea trifoliata
speciesAt a glance
Occurrence records14 960
Data sources16
Biological traits116
DNA specimens13
eDNA detections9
Sources16 archives
Databases and archives Ptelea trifoliata's data was compiled from.
WikipediaWikimedia Foundation9 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility14 960 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics13 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources116 traits
Chemical compositionLOTUS · NPASS30 compounds
Occurrence & distributionGBIF14 960 records
Environmental DNA1 datasets · 3 countries9 detections
DNA & barcodingBOLD · NCBI13 specimens
Genome at a glanceCCDB802 Mbp
01Narrative
Ptelea trifoliata, commonly known as common hoptree, wafer ash,Ptelea trifoliata Lady Bird Johnson Wildflower Center stinking ash, and skunk bush, is a species of flowering plant in the citrus family (Rutaceae). It is native to North America, where it is found in Canada, Mexico, and the United States. It is a deciduous shrub or tree,USDA – Ptelea trifoliata (common hoptree). Accessed 8.24.2011ITIS Standard Report Page: Ptelea trifoliata. Accessed 8.24.2011 with alternate, trifoliate leaves.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTUSDATRY
Size & morphology14
Fruit length20.5 mm
Fruit length max22 mm
Fruit length min19 mm
Fruit width2.6 mm
Fruit width max2.9 mm
Fruit width min2.3 mm
Plant height6.66 m
⚠ sources differ — GIFT: 6.66 m · USDA: 7.62 m · TRY: 6.98 m
Plant height generative2.1 m
Plant height max8 m
Plant height min1.5 m
Seed length8 mm
Seed mass27.33 mg
Seed mass max45.45 mg
Seed mass min10.4 mg
Life cycle & reproduction29
Bloom periodEarly Summer
Coppice potentialNo
Deciduousnessdeciduous
Dehiscenceindehiscent
Dispersal typewind
Flower colouryellow
Flower conspicuousNo
Flowering endAug
Flowering startApr
Fruit seed period beginSummer
Fruit seed period endSummer
Growth rate USDASlow
Life formshrub or tree
Life spanperennial
Lifespan categoryLong
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formphanerophyte
Resprout abilityYes
Seed spread rateSlow
Seedling vigorLow
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment26
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureMedium
Fruit colourred
Fruit typeachene
Growth formtree
⚠ sources differ — GIFT: tree · TRY: Tree, Shrub
Growth form USDASingle Stem
Hedge toleranceNone
Known allelopathNo
Leaf retentionYes
Low growing grassNo
Mycorrhiza type0.0000000000492
Root depth min30 in
Shape and orientationErect
Small grainNo
Woodinesswoody
Physiology & chemistry19
Anaerobic toleranceLow
C:N ratioHigh
Caco3 toleranceMedium
Cold stratification requiredYes
Drought toleranceLow
Fertility requirementLow
Fire resistantNo
Fire toleranceLow
Frost free days min165 days
Moisture useHigh
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max50 in
Precipitation min30 in
Salinity toleranceMedium
Shade toleranceMedium
Soil pH max7 pH
Soil pH min4.8 pH
Temperature min-33 °F
Uses & economy16
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityNo Known Source
Fodder productNo
Fuelwood productMedium
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound12 000 per lb
ToxicityNone
Veneer productNo
Other traits11
Diaspore typegenerative dispersule
Fall conspicuousYes
Fruit height18.75 mm
Fruit height max21 mm
Fruit height min21 mm
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
Height at 20yr6.1 m
Planting density max700 per acre
Planting density min300 per acre
03Chemical composition30 compounds
Compounds documented for Ptelea trifoliata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Quinoline alkaloids17
Acridone alkaloids $ Quinoline alkaloids1
Pterocarpan1
Aminoacids1
Dibenzylbutyrolactone lignans1
Documented compounds30 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (13R)-16-methyl-13-prop-1-en-2-yl-3,5,14-trioxa-16-azatetracyclo[7.7.0.02,6.011,15]hexadeca-1(9),2(6),7,11(15)-tetraen-10-one | present | LOTUS | |
| (2R,9R)-6,8-dimethoxy-9-(methylamino)-2-prop-1-en-2-yl-1,2,3,9-tetrahydrocyclopenta[b]naphthalen-4-one | present | LOTUS | |
| (2S,3R,4S)-2-amino-3-hydroxy-4-methylpentanedioic acid | present | NPASS | |
| (4R)-2,2,6-trimethyl-4-[(2E)-2-(9-methyl-4-oxo-3H-furo[2,3-b]quinolin-2-ylidene)propyl]-3,4-dihydropyrano[3,2-c]quinolin-5-one | present | LOTUS | |
| (4S)-2,2,6-trimethyl-4-[(2E)-2-(5-methyl-4-oxo-3H-furo[3,2-c]quinolin-2-ylidene)propyl]-3,4-dihydropyrano[3,2-c]quinolin-5-one | present | LOTUS | |
| (5S)-2-methoxy-6,6-dimethyl-7,12,14-trioxa-9-azatetracyclo[8.7.0.03,8.011,15]heptadeca-1(10),2,8,11(15),16-pentaen-5-ol | present | LOTUS | |
| 2,2,6-trimethyl-4-[2-(5-methyl-4-oxo-3H-furo[3,2-c]quinolin-2-ylidene)propyl]-3,4-dihydropyrano[3,2-c]quinolin-5-one | present | LOTUS | |
| 2-Undecyl-4(1H)-quinolone | present | LOTUS | |
| 3-(2-Hydroxy-3-methylbut-3-enyl)-4,6,8-trimethoxy-1-methylquinolin-2-one | present | LOTUS | |
| 3-[(2R)-2-hydroxy-3-methylbut-3-enyl]-4,6,8-trimethoxy-1-methylquinolin-2-one | present | LOTUS |
05DNA & barcoding13 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ptelea trifoliata has left across the world's sequence archives.
At a glance
DNA specimens13
Marker genes5
GenBank sequences7
eDNA detections9
Countries4
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAAGCTGTTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATC …
Ptelea trifoliata voucher 81176HIM 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL4★rbcLa★ITS3★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Ptelea trifoliata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size801 960 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Ptelea trifoliata0.80 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 42 n = 21
Ploidy2× diploid · measured
Chromosome records36–422n range42median42mode5records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 424×CCDB · ipcn-api-dl · CCDB · book-fedorov · CCDB · kew
CCDB · ipcn-api-dl — Guerra, M. d. S. 1984. New chromosome numbers in Rutaceae. Pl. Syst. Evol. 146: 13–30.
CCDB · book-fedorov — Desai 1960
CCDB · kew — Guerra M dos S. 1984. Cytogenetics of Rutaceae. 2. Nuclear DNA content. Caryologia 37: 219-226.
2n 361×CCDB · book-fedorov
CCDB · book-fedorov — Negodi 1937f
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type14 960 records
Wild obs. + sensor12 363
Museum / vouchered2 569
Cultivated / captive16
Fossil2
Other10
Origin
Native9
Introduced42
Range
Area of Occupancy AOO26 084 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy86% within 1 km
≤100 m 7 532≤1 km 1 176≤10 km 550>10 km 847
10 105 georeferenced · 2 258 without coordinates
Open the mapobservation + sensor12 363
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy64% within 1 km
≤100 m 616≤1 km 274≤10 km 416>10 km 85
1 391 georeferenced · 1 178 without coordinates
Open the institutions mapphysical evidence2 569
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤1 km 5
5 georeferenced · 11 without coordinates
Open the mapnot free-living16
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions130 of 206 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Durango, MX | 166 |
| Mexico City, MX | 151 |
| ASUlocation not on record | 144 |
| Mexico City, MX | 115 |
| Jena Microbial Resource Collectionlocation not on record | 102 |
| Austin, US | 87 |
| Fort Worth, US | 72 |
| Bronx, US | 70 |
| Ciudad de México, MX | 64 |
| Phoenix, US | 60 |
| Bangkok, TH | 55 |
| EL PASO, US | 54 |
| Albuquerque, US | 45 |
| Anchorage, US | 44 |
| BAYLUlocation not on record | 42 |
| Saint Louis, US | 41 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 32 |
| Bloomington, US | 30 |
| University of Stellenboschlocation not on record | 28 |
| Chapel Hill, US | 27 |
| Tampa, US | 27 |
| Ann Arbor, US | 26 |
| Flagstaff, US | 25 |
| New Haven, US | 25 |
| Moscow State Universitylocation not on record | 23 |
| University of New Hampshirelocation not on record | 23 |
| Chapingo, MX | 23 |
| Juriquilla, MX | 22 |
| Riverside, US | 21 |
| Adam Mickiewicz University in Poznańlocation not on record | 20 |
| Denver, US | 19 |
| Dekalb, US | 19 |
| College Park, US | 18 |
| Museo Entomologico de Leonlocation not on record | 17 |
| Macomb, US | 17 |
| Davenport, US | 17 |
| Jackson, US | 16 |
| Texas Lutheran Universitylocation not on record | 16 |
| Chongqing Museumlocation not on record | 16 |
| Tuscaloosa, US | 15 |
| GAlocation not on record | 15 |
| Western Carolina Universitylocation not on record | 14 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 13 |
| Knoxville, US | 12 |
| Giardini Botanici Hanburylocation not on record | 12 |
| Claremont, US | 11 |
| Zacatecas, MX | 11 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 11 |
| San Angelo, US | 11 |
| Austin, US | 11 |
| Puebla, MX | 10 |
| Beijing, CN | 9 |
| Fayetteville, US | 9 |
| Philadelphia, US | 9 |
| Staten Island, US | 9 |
| Autlán de Navarro, MX | 9 |
| Auckland, NZ | 9 |
| Tlalnepantla, MX | 8 |
| Miami, US | 8 |
| BRNUlocation not on record | 8 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 8 |
| Valdosta State Universitylocation not on record | 8 |
| McWane Science Centerlocation not on record | 8 |
| Oskarshamn, SE | 7 |
| FFPRIlocation not on record | 7 |
| US | 7 |
| Lubbock, US | 7 |
| University of Southern Mississippilocation not on record | 7 |
| DOI/NPS, Greenbelt Parklocation not on record | 7 |
| Lincoln, US | 7 |
| Guasave, MX | 7 |
| Madison, US | 7 |
| Burlington, US | 6 |
| AUAlocation not on record | 6 |
| Lord Fairfax Community Collegelocation not on record | 6 |
| Canadian Department of Agriculturelocation not on record | 6 |
| Williamsburg, US | 6 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 5 |
| Uniwersytet Warszawskilocation not on record | 5 |
| Clemson, US | 5 |
| Mexico City, MX | 5 |
| BClocation not on record | 5 |
| Montréal, CA | 5 |
| Mississippi State, US | 5 |
| Moscow, US | 5 |
| Tall Timbers Research Stationlocation not on record | 5 |
| Columbia, US | 5 |
| US | 5 |
| Mlocation not on record | 4 |
| Maryland Department of Natural Resourceslocation not on record | 4 |
| University of Tennessee at Chattanoogalocation not on record | 4 |
| Nanjing, CN | 4 |
| Chicago, US | 4 |
| Denton, US | 4 |
| Hermosillo, MX | 4 |
| Durham, US | 4 |
| Little Rock, US | 4 |
| Norfolk, US | 4 |
| PRClocation not on record | 4 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 3 |
| Karlsruhe, DE | 3 |
| Boise, US | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| Durham, US | 3 |
| Bern, CH | 3 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 3 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 3 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 3 |
| LDlocation not on record | 3 |
| Wlocation not on record | 3 |
| Tartu, EE | 3 |
| Asheville, US | 3 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 3 |
| Uniwersytet Jagiellońskilocation not on record | 2 |
| Mérida, MX | 2 |
| Acadia Universitylocation not on record | 2 |
| Chicago, US | 2 |
| BDBClocation not on record | 2 |
| Northridge, US | 2 |
| The University of Arizonalocation not on record | 2 |
| Berlin, DE | 2 |
| Kingston, US | 2 |
| Rotorua, NZ | 2 |
| San Diego, US | 2 |
| Edmonton, CA | 2 |
| Cambridge, US | 2 |
| Linares, MX | 2 |
| Provo, US | 2 |
| Durango, US | 2 |
| USFSlocation not on record | 2 |
| Grand Junction, US | 2 |
| San Luis Potosí, MX | 2 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| Québec, CA | 2 |
| Whitewater, US | 2 |
| Logan, US | 2 |
| Long Beach, US | 2 |
| Herbarium of South China Botanical Gardenlocation not on record | 2 |
| Philadelphia, US | 2 |
| MAlocation not on record | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| North Carolina Museum of Natural Scienceslocation not on record | 1 |
| Tapachula, MX | 1 |
| Pocatello, US | 1 |
| Pullman, US | 1 |
| Henderson, US | 1 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 1 |
| Zapopan, MX | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| Fairfax, US | 1 |
| China Agricultural Universitylocation not on record | 1 |
| Emporia, US | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| La Paz, MX | 1 |
| Université Lavallocation not on record | 1 |
| Christchurch, NZ | 1 |
| Vancouver, CA | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Due West, US | 1 |
| North Carolina Zoological Parklocation not on record | 1 |
| Parkville, AU | 1 |
| Podgorica, ME | 1 |
| Los Angeles, US | 1 |
| MeiseBGlocation not on record | 1 |
| Universität Göttingenlocation not on record | 1 |
| SNSNMClocation not on record | 1 |
| US | 1 |
| CASlocation not on record | 1 |
| Dresden, DE | 1 |
| JBRJlocation not on record | 1 |
| BGBMlocation not on record | 1 |
| Millersville, US | 1 |
| Green Bay, US | 1 |
| Portland, US | 1 |
| Brussel, BE | 1 |
| San Luis Obispo, US | 1 |
| Bando, JP | 1 |
| Odawara, JP | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
| Voronezh State Universitylocation not on record | 1 |
| Walla Walla, US | 1 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 1 |
| Kew, GB | 1 |
| MEXUlocation not on record | 1 |
| UoB-IBlocation not on record | 1 |
| USP-IBlocation not on record | 1 |
| Kunming, CN | 1 |
| Olocation not on record | 1 |
| Elikins, US | 1 |
| Fredericksburg, US | 1 |
| BFLlocation not on record | 1 |
| KMNlocation not on record | 1 |
| Morelia, MX | 1 |
| SLU Artdatabankenlocation not on record | 1 |
| Santa Barbara, US | 1 |
| Whitehorse, CA | 1 |
| Turlock, US | 1 |
| Chadron, US | 1 |
| GJOlocation not on record | 1 |
| Angwin, US | 1 |
| Görlitz, DE | 1 |
| Hobart, AU | 1 |
| Instituto Nacional de Estadística y Geografíalocation not on record | 1 |
| Davis, US | 1 |
| Richmond, US | 1 |
206 institutions · 2 421 of 2 569 vouchered records shown · 135 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA9 detections
Where the DNA of Ptelea trifoliata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found9
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 9 detections have coordinates
Open the map3 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median21.9 °C 12.6–25.2
Seasonal swing summer↔winter25.6 °C
Max temp (day)24.6 °C 17.0–28.5
Min temp (night)19.9 °C 9.10–21.2
Precipitation93.8 mm/mo 75.3–232
Air humidity62.0 % 59.0–64.0
Moisture balance-6.80 mm/mo -79.4–114
Vapour deficit1,077 Pa 585–1,153
Wind speed3.90 m/s 1.70–4.70
Cloud cover41.8 % 38.6–45.7
CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.