Ptelea crenulata

Greene · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Ptelea

At a glance

Occurrence records1 098

Data sources10

Biological traits10

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Ptelea crenulata's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 098 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS · NPASS15 compounds

Occurrence & distributionGBIF1 098 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Ptelea crenulata, commonly known as the California hoptree, is a species of tree that is endemic to the state of California in the United States. It is found in the western Sierra Nevada and southern Cascade Range foothills, the northern California Coast Ranges, and the San Francisco Bay Area.USDA—Ptelea crenulata. Accessed 8.20.2011Calflora.org: Ptelea crenulata. Accessed 8.24.2011UC: Jepson Manual treatment for PTELEA crenulata . accessed 8.20.2011 The plant grows in chaparral and woodlands habitats. It is cultivated by specialty California native plant nurseries as an ornamental plant for use as a shrub or small tree in water conserving gardens, natural landscaping design, and habitat restoration projects.UC: Jepson Horticultural Database for Ptelea crenulata. Accessed 8.20.2011CNPLX: Ptelea crenulata—Nursery and Seed Sources . accessed 8.20.2011

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass10.43 mg

Seed mass max10.43 mg

Seed mass min10.43 mg

Life cycle & reproduction2

Life formshrub or tree

Life spanperennial

Habitat & environment4

Climatetemperate

Climberself-supporting

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Tree, Shrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition15 compounds

Compounds documented for Ptelea crenulata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Furofuranoid lignans2

Arylnaphthalene and aryltetralin lignans $ Dibenzylbutane lignans2

Stigmastane steroids2

Chromones2

Quinoline alkaloids1

Documented compounds15 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,3S)-2,3-bis(1,3-benzodioxol-5-ylmethyl)butane-1,4-diol	present	NPASS
(8R)-8-hydroxy-2-(6-phenylhexyl)-5,6,7,8-tetrahydrochromen-4-one	present	NPASS
(8R)-8-hydroxy-2-nonyl-5,6,7,8-tetrahydrochromen-4-one	present	NPASS
1-(2,6-Dihydroxyphenyl)Dodecan-1-One	present	NPASS
5,7-Dihydroxy-2-(6-phenylhexyl)chromen-4-one	present	NPASS
5,7-Dihydroxy-2-Nonylchromen-4-One	present	NPASS
Asarinin	present	NPASS
beta-Sitosterol	present	NPASS
Dihydrocubebin	present	NPASS
Dodecanoylphloroglucinol	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ptelea crenulata has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences6

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF963929.1 ↗708 bpUSA

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACTCGTAGAGCAGAATGACCCGTGAACTCGTAGAAAAAC …

Ptelea crenulata isolate CBP192 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type1 098 records

Wild obs. + sensor878

Museum / vouchered220

Range

Area of Occupancy AOO896 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 512≤1 km 79≤10 km 47>10 km 24

662 georeferenced · 216 without coordinates

Open the mapobservation + sensor878

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 10≤1 km 57≤10 km 75>10 km 4

146 georeferenced · 74 without coordinates

Open the institutions mapphysical evidence220

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	25
Davis, US	20
Canadian Department of Agriculturelocation not on record	11
CASlocation not on record	9
Arcata, US	7
Riverside, US	5
Santa Barbara, US	5
Claremont, US	4
US	4
San Diego, US	4
San Luis Obispo, US	2
Bloomington, US	2
Angwin, US	2
Severin-McDaniel Insect Collectionlocation not on record	2
San Jose, US	2
Los Angeles, US	2
Chadron, US	1
Corvallis, US	1
Lubbock, US	1
DOI/NPS, Colonial National Historical Parklocation not on record	1
Northridge, US	1
Santa Cruz, US	1
Jena Microbial Resource Collectionlocation not on record	1
Mexico City, MX	1
EL PASO, US	1

25 institutions · 115 of 220 vouchered records shown · 105 without an institution code

09Environmental DNA1 detections

Where the DNA of Ptelea crenulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ptelea crenulata

At a glance

Sources10 archives

Size & morphology3

Life cycle & reproduction2

Habitat & environment4

Physiology & chemistry1

Compound class profile5 classes

Documented compounds15 total

At a glance

Record type1 098 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions19 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 098 records