Psylliostachys suworowii

(Regel) Roshkova · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Plumbaginaceae/Psylliostachys

At a glance

Occurrence records71

Data sources6

Biological traits18

DNA specimens3

eDNA detections3

Sources6 archives

Databases and archives Psylliostachys suworowii's data was compiled from.

GBIFGlobal Biodiversity Information Facility71 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources18 traits

Occurrence & distributionGBIF71 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.8 m

Plant height min0.1 m

Life cycle & reproduction5

Flowering endMay

Flowering startApr

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max1 400 m

Elevation min300 m

Growth formherb

Habitat GIFThills, plains, saline places, sand

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psylliostachys suworowii has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences4

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSAJ132446.1 ↗620 bp

ACGT

ATTGTCGAAACCTGCAATAGCAGAGCCACACGTGAACTTGTTTTTAAACCTTCTTTGTCGTGCGATGGATGGTTGCCGCGTGCCTCCTCC …

Psylliostachys suworowii internal transcribed spacer 1 (ITS1) 5.8S rRNA gene and internal transcribed spacer 2 (ITS2)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type71 records

Wild obs. + sensor48

Museum / vouchered23

Range

Area of Occupancy AOO196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 15≤1 km 1>10 km 1

17 georeferenced · 31 without coordinates

Open the mapobservation + sensor48

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	4
Paris, FR	3
Uniwersytet Opolskilocation not on record	3
Denver, US	2
South Kensington, GB	2
Edinburgh, GB	1
Auckland, NZ	1
LDlocation not on record	1
DOI/NPS, Colonial National Historical Parklocation not on record	1
València, ES	1

10 institutions · 19 of 23 vouchered records shown · 4 without an institution code

09Environmental DNA3 detections

Where the DNA of Psylliostachys suworowii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)