Psydrax obovatus

(Klotzsch ex Eckl. & Zeyh.) Bridson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Psydrax

At a glance

Occurrence records176

Data sources6

Biological traits14

DNA specimens0

eDNA detections8

Sources6 archives

Databases and archives Psydrax obovatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility176 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources14 traits

Occurrence & distributionGBIF176 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingNCBIsequences

01Narrative

Psydrax obovata là một loài thực vật có hoa trong họ Thiến thảo. Loài này được Bridson miêu tả khoa học đầu tiên năm 1985.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology2

Plant height max15 m

Plant height min1.5 m

Life cycle & reproduction3

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 830 m

Elevation min5 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psydrax obovatus has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences10

eDNA detections8

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJQ957998.1 ↗665 bp

ACGT

GATCATTGTCGAAGCCTGAAACGGACGACCGCGAACACGTTCTGACAGCCGCGCCGCGGGGAAGGCGCGCGGAGACTCAACCCTCCCCGT …

Psydrax obovatus voucher Lemaire & Verstraete 188 (BR) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL4★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type176 records

Wild obs. + sensor161

Museum / vouchered15

Range

Area of Occupancy AOO580 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 99≤1 km 23>10 km 1

123 georeferenced · 38 without coordinates

Open the mapobservation + sensor161

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	2
University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record	2
South African National Biodiversity Institutelocation not on record	1
Zürich, CH	1
Kew, GB	1
Bronx, US	1
MeiseBGlocation not on record	1

7 institutions · 9 of 15 vouchered records shown · 6 without an institution code

09Environmental DNA8 detections

Where the DNA of Psydrax obovatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.7 °C 17.4–23.9

Seasonal swing summer↔winter7.40 °C

Max temp (day)25.3 °C 22.0–28.6

Min temp (night)15.9 °C 13.0–18.7

Precipitation70.9 mm/mo 39.3–102

Air humidity55.5 % 53.0–58.1

Moisture balance-50.1 mm/mo -54.7–-45.6

Vapour deficit1,092 Pa 935–1,249

Wind speed3.30 m/s 3.10–3.40

Cloud cover26.6 % 11.6–41.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)