Psydrax dicoccos

Gaertn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Psydrax

At a glance

Occurrence records264

Data sources12

Biological traits21

DNA specimens16

eDNA detections9

Sources12 archives

Databases and archives Psydrax dicoccos's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility264 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Chemical compositionLOTUS · NPASS100 compounds

Occurrence & distributionGBIF264 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD · NCBI16 specimens

Genome at a glanceCCDB2n = 44

01Narrative

Psydrax dicoccos is a species of flowering plant in the family Rubiaceae. It is found from southeast China to tropical Asia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Leaf size5 508 mm²

Plant height11 m

⚠ sources differ — GIFT: 11 m · TRY: 15 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry8

Leaf C:N ratio42.78 g/g

Leaf dry-matter content (LDMC)319 mg/g

Leaf n19.37 mg/g

Leaf p0.5 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)12.92 mm²/mg

Wood density712 mg/cm³

03Chemical composition100 compounds

Compounds documented for Psydrax dicoccos across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Chamigrane sesquiterpenoids19

Laurane sesquiterpenoids9

Secochamigrane sesquiterpenoids6

Fatty alcohols5

Eudesmane sesquiterpenoids3

Documented compounds100 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,1'S,2'S,5R,6S)-2',3-dibromo-1'-chloro-1',4,4,6-tetramethylspiro[7-oxabicyclo[4.1.0]hept-2-ene-5,4'-cyclohexane]	present	NPASS
(1R,1'S,4'S,5R,5'S,6S)-3,4'-dibromo-5'-chloro-4,4,5',6-tetramethylspiro[7-oxabicyclo[4.1.0]hept-2-ene-5,2'-cyclohexane]-1'-ol	present	NPASS
(1R,3R,5R,6R,8R)-5-bromo-3-[(1S)-1-bromopropyl]-8-[(Z)-pent-2-en-4-ynyl]-2,7-dioxabicyclo[4.2.1]nonane	present	NPASS
(1R,3R,5R,6R,8S)-5-bromo-3-[(1S)-1-bromopropyl]-8-[(Z)-pent-2-en-4-ynyl]-2,7-dioxabicyclo[4.2.1]nonane	present	NPASS
(1R,3R,6S,8R,11R)-8-bromo-4,11,12,12-tetramethyl-7-oxatricyclo[6.3.1.01,6]dodeca-4,9-diene-3,11-diol	present	NPASS
(1R,4E,6S)-1-methyl-4-(6-methylhept-5-en-2-ylidene)-7-oxabicyclo[4.1.0]heptane	present	NPASS
(1R,5R,7S)-9-bromo-8,8-dimethyl-11-methylidene-5-prop-1-en-2-yl-2,4-dioxabicyclo[5.3.1]undec-9-ene	present	NPASS
(1R,5S,7R,8S)-8-chloro-2,2,5,8-tetramethyl-6-oxatricyclo[5.3.1.01,5]undec-3-ene-3-carbaldehyde	present	NPASS
(1R,6S,8R,11R)-3,8-dibromo-4,11,12,12-tetramethyl-7-oxatricyclo[6.3.1.01,6]dodeca-3,9-dien-11-ol	present	NPASS
(1R,6S,8R,11R)-8-bromo-4,11,12,12-tetramethyl-7-oxatricyclo[6.3.1.01,6]dodeca-3,9-dien-11-ol	present	NPASS

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psydrax dicoccos has left across the world's sequence archives.

At a glance

DNA specimens16

Marker genes4

GenBank sequences8

eDNA detections9

Countries3

The DNA barcodea real sequence read deposited for this species

ITSOR199631.1 ↗457 bpChina

ACGT

GGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCG …

Psydrax dicoccos voucher NG197 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL4★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Psydrax dicoccos carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 441×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Philip, O. & Mathew, P.M. 1975b

n 221×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Philip & Mathew 1975

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type264 records

Wild obs. + sensor124

Museum / vouchered140

Range

Area of Occupancy AOO788 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 48≤1 km 13≤10 km 4>10 km 56

121 georeferenced · 3 without coordinates

Open the mapobservation + sensor124

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤1 km 37≤10 km 3

40 georeferenced · 100 without coordinates

Open the institutions mapphysical evidence140

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	41
Saint Louis, US	9
Yangling, CN	3
Sri Ramaswamy Memorial Universitylocation not on record	3
Paris, FR	2
Kew, GB	2
Herbarium of South China Botanical Gardenlocation not on record	2
National Institute of Biological Resourceslocation not on record	1
Cambridge, US	1
Kagoshima, JP	1
Xiamen, CN	1
NGCPR01333location not on record	1
NGCPR01332location not on record	1
Servico de Microbiologia e Imunologialocation not on record	1
Vietnam Academy of Science and Technology (VAST)location not on record	1
South Kensington, GB	1

16 institutions · 71 of 140 vouchered records shown · 69 without an institution code

09Environmental DNA9 detections

Where the DNA of Psydrax dicoccos was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 19.7–25.1

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C 24.2–30.5

Min temp (night)19.3 °C 14.3–19.3

Precipitation109 mm/mo 109–157

Air humidity52.0 % 52.0–61.6

Moisture balance-17.8 mm/mo -17.8–49.4

Vapour deficit1,616 Pa 959–1,616

Wind speed1.80 m/s

Cloud cover25.2 % 25.2–38.1

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)