Psychotria dallachiana

Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Psychotria

At a glance

Occurrence records346

Data sources7

Biological traits31

DNA specimens5

eDNA detections5

Sources7 archives

Databases and archives Psychotria dallachiana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility346 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources31 traits

Occurrence & distributionGBIF346 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Psychotria dallachiana is a rainforest plant growing in north eastern Australia. The fruit is food for the cassowary.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology10

Fruit length10.5 mm

Fruit width10.5 mm

Leaf length90 mm

Leaf mass per area78.35 g/m2

Leaf size2 780 mm²

Leaf width32.5 mm

Plant height3 m

Seed length6 mm

Seed mass13 mg

Seed width4.5 mm

Life cycle & reproduction7

Deciduousnessevergreen

Dispersal typeanimal

Flowering timeyynnnnnyyyyy

Life spanperennial

Pollination syndromemoth

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formshrub

Leaf compoundnesssimple

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)12.66 mm²/mg

Wood density562 mg/cm³

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psychotria dallachiana has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences3

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKF675929.1 ↗699 bp

ACGT

CGCTGCCCGCGACGTCGCAAGAAGTCCATTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGG …

Psychotria dallachiana voucher Barrabe & Rigault 1053 (NOU) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★rbcLa★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type346 records

Wild obs. + sensor26

Museum / vouchered274

Other46

Origin

Native11

Range

Area of Occupancy AOO736 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 12≤1 km 2≤10 km 1

15 georeferenced · 11 without coordinates

Open the mapobservation + sensor26

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 56≤1 km 25≤10 km 119>10 km 21

221 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence274

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	109
Smithfield, AU	102
Museo Entomologico de Leonlocation not on record	16
Mount Annan, AU	9
Canberra, AU	9
James Cook Townsvillelocation not on record	7
Kew, GB	4
Palmerston, AU	2
John T. Waterhouse Herbariumlocation not on record	1
Armidale, AU	1
University of the Sunshine Coastlocation not on record	1

11 institutions · 261 of 274 vouchered records shown · 12 without an institution code

09Environmental DNA5 detections

Where the DNA of Psychotria dallachiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 16.6–23.6

Seasonal swing summer↔winter8.30 °C

Max temp (day)27.5 °C 21.3–28.3

Min temp (night)15.0 °C 11.9–19.4

Precipitation36.9 mm/mo 19.8–314

Air humidity60.1 % 46.7–67.3

Moisture balance-69.4 mm/mo -128–139

Vapour deficit922 Pa 737–1,484

Wind speed3.40 m/s 2.20–3.90

Cloud cover29.2 % 20.3–54.5

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)