Psychotria capensis

(Eckl.) Vatke · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Psychotria

At a glance

Occurrence records1 198

Data sources10

Biological traits27

DNA specimens8

eDNA detections6

Sources10 archives

Databases and archives Psychotria capensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 198 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources27 traits

Occurrence & distributionGBIF1 198 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceCCDB2n = 44

01Narrative

پسیکتریا دماغه نام یک گونه از تیره روناسیان است.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height2.5 m

⚠ sources differ — GIFT: 2.5 m · TRY: 10 m

Plant height max4 m

Plant height min2 m

Seed mass2 059 mg

Seed mass max6 095 mg

Seed mass min37.98 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max2 170 m

Elevation min5 m

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: tree

Habitat GIFTriverine or swampy sites, forest

Woodinesswoody

Physiology & chemistry7

Leaf C:N ratio20.55 g/g

Leaf c482 mg/g

Leaf n22.67 mg/g

Leaf p1.73 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)14.89 mm²/mg

Wood density515 mg/cm³

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psychotria capensis has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes4

GenBank sequences8

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAF149370.1 ↗432 bp

ACGT

ACGACCGCGAACAAGTTCATCAAACATGGGTTGCGGCGGGCTTGGGAAACCTCGCTAGTCAGCAATCTCACCAAACTTAACTCTCGGCGC …

Psychotria capensis internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★rbcLa★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Psychotria capensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 221×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Kiehn, M. 1985. Karyosystematische Untersuchungen an Rubiaceae: Chromosomenzählungen aus Afrika, Madagaskar und Mauritius. Pl. Syst. Evol. 149: 89–118.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 198 records

Wild obs. + sensor873

Museum / vouchered325

Range

Area of Occupancy AOO2 212 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 563≤1 km 135≤10 km 31>10 km 5

734 georeferenced · 139 without coordinates

Open the mapobservation + sensor873

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy98% within 1 km

≤100 m 174≤1 km 1≤10 km 4

179 georeferenced · 146 without coordinates

Open the institutions mapphysical evidence325

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	192
Saint Louis, US	38
MeiseBGlocation not on record	29
Kew, GB	22
Pretoria, ZA	4
University of Johannesburglocation not on record	3
Bronx, US	3
Claremont, US	3
Arusha, TZ	2
Karlsruhe, DE	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Stockholm, SE	1
MAlocation not on record	1
Durban, ZA	1
Auckland, NZ	1
Instituto de Investigação Científica Tropicallocation not on record	1
Chongqing Museumlocation not on record	1
University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record	1
South Kensington, GB	1
Uppsala, SE	1
UJlocation not on record	1

22 institutions · 311 of 325 vouchered records shown · 14 without an institution code

09Environmental DNA6 detections

Where the DNA of Psychotria capensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.8 °C 19.8–20.2

Seasonal swing summer↔winter6.60 °C

Max temp (day)24.9 °C 24.9–25.2

Min temp (night)15.4 °C 15.4–15.6

Precipitation28.3 mm/mo 28.3–47.7

Air humidity62.3 % 59.4–62.3

Moisture balance-50.3 mm/mo -63.0–-50.3

Vapour deficit868 Pa 868–965

Wind speed1.80 m/s 1.80–3.60

Cloud cover14.1 % 14.1–18.0

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Psychotria capensis

At a glance

Sources10 archives

Size & morphology6

Life cycle & reproduction4

Diet & foraging1

Habitat & environment9

Physiology & chemistry7

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 198 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 198 records