Psychoda sigma

Kincaid, 1899 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Psychodidae/Psychoda

At a glance

Occurrence records2 276

Data sources6

Biological traits0

DNA specimens815

eDNA detections893

Sources6 archives

Databases and archives Psychoda sigma's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 276 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI893 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics815 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 276 records

Environmental DNA3 datasets · 12 countries893 detections

DNA & barcodingBOLD815 specimens

01Narrative

Psychoda sigma is een muggensoort uit de familie van de motmuggen (Psychodidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1899 door Kincaid.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding815 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psychoda sigma has left across the world's sequence archives.

At a glance

DNA specimens815

BINs1

Marker genes1

eDNA detections893

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus810 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

115Cvariable

157Avariable

226Gmostly conserved

331Gvariable

353Tmostly conserved

370Cmostly conserved

415Cvariable

430Avariable

493Amostly conserved

550Cvariable

559Tvariable

622Gvariable

628Amostly conserved

CCTTTATTTTATTTTTGGTAGATGAGCTAGAATAGTAGGTACATCTCTAAGAATAATTATTCGAGCAGAATTAGGTCATCCTGGATCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.94%

Haplotypes25

BIN1

Most divergent pair2.6%

EuropeS.AmericaN.AmericaOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Psychoda mycophilasame genus9.5%Psychoda setigerasame genus10.1%Psychoda divaricatasame genus10.4%Psychoda uncinulasame genus10.7%Psychoda geminasame genus10.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 276 records

Wild obs. + sensor1 171

Museum / vouchered1 105

Range

Area of Occupancy AOO3 216 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy44% within 1 km

≤100 m 375≤1 km 73≤10 km 517>10 km 50

1 015 georeferenced · 156 without coordinates

Open the mapobservation + sensor1 171

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1 078≤1 km 17

1 095 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence1 105

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	12
Gothenburg, SE	3
Washington, US	2

3 institutions · 17 of 1 105 vouchered records shown · 1 088 without an institution code

09Environmental DNA893 detections

Where the DNA of Psychoda sigma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found893

Studies independent surveys3

Countries12

Verifiable raw sequence linked21

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 893 detections have coordinates

Open the map12 countries0

Forest1. Forest & Woodland|1.4. Temperate ForestFarmenvironment, farmland, coast and birch h…14. Artificial - Terrestrial|14.5 Urban AreasFarmland, coast and birch habitat1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.0 °C 9.40–16.0

Seasonal swing summer↔winter9.80 °C

Max temp (day)15.6 °C 12.8–18.5

Min temp (night)9.10 °C 5.50–12.9

Precipitation120 mm/mo 50.7–169

Air humidity62.4 % 58.3–64.8

Moisture balance16.1 mm/mo -57.3–96.9

Vapour deficit539 Pa 431–731

Wind speed4.20 m/s 3.10–4.80

Cloud cover36.6 % 30.9–63.5

CHELSA 1981–2010, ~9 km grid, at location & month of 890 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Psychoda sigma

At a glance

Sources6 archives

At a glance

Record type2 276 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 3 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 276 records