Psora pseudorussellii

Timdal · species

image placeholder — illustration coming later

Fungi/Ascomycota/Lecanoromycetes/Lecanorales/Psoraceae/Psora

At a glance

Occurrence records828

Data sources6

Biological traits1

DNA specimens29

eDNA detections18

Sources6 archives

Databases and archives Psora pseudorussellii's data was compiled from.

GBIFGlobal Biodiversity Information Facility828 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF828 records

Environmental DNA1 datasets · 3 countries18 detections

DNA & barcodingBOLD · NCBI29 specimens

02Traits & measurements

SourcesTRY

Habitat & environment1

Growth formlichen

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psora pseudorussellii has left across the world's sequence archives.

At a glance

DNA specimens29

Marker genes4

GenBank sequences9

eDNA detections18

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKY426121.1 ↗512 bp

ACGT

CATTACCGAGAGGGGCTCACGGCCTCAGGGGGCTTCGTCCCCCGTCTCTCCACCCGTGAACAACCTACCTTTCCGTTGCTTTGGCGGGAC …

Psora pseudorussellii voucher O-L-156015 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9★ITS1mtSSURPB1

fungal barcodemarker

08Occurrence & distribution

Record type828 records

Wild obs. + sensor446

Museum / vouchered382

Range

Area of Occupancy AOO2 156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 176≤1 km 37≤10 km 9>10 km 80

302 georeferenced · 144 without coordinates

Open the mapobservation + sensor446

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 2≤1 km 11≤10 km 84>10 km 3

100 georeferenced · 282 without coordinates

Open the institutions mapphysical evidence382

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	85
Madison, US	45
Wuzhou, CN	44
Museum of the Rockieslocation not on record	41
St. Paul, US	31
ASUlocation not on record	18
EL PASO, US	17
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	10
ILLSlocation not on record	10
DOI/NPS, Colonial National Historical Parklocation not on record	8
Olocation not on record	8
AUAlocation not on record	7
University of Oslo, Natural History Museumlocation not on record	6
Durham, US	5
Chicago, US	5
PHlocation not on record	5
Stockholm, SE	4
Burlington, US	4
University of Stellenboschlocation not on record	3
Arizona State Universitylocation not on record	2
Santa Barbara Botanic Gardenlocation not on record	2
Botanical Research Institute of Texaslocation not on record	2
Berlin, DE	1
University of Colorado, Boulderlocation not on record	1
McWane Science Centerlocation not on record	1
Auburn University Museum of Natural Historylocation not on record	1
Uppsala, SE	1
Fort Hayslocation not on record	1
Fort Worth, US	1
Boise, US	1
Santa Barbara, US	1
Université Lavallocation not on record	1

32 institutions · 372 of 382 vouchered records shown · 10 without an institution code

09Environmental DNA18 detections

Where the DNA of Psora pseudorussellii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map3 countries0

Canotia and other desert vegetation, on lime…on exposed metamorphic (greenstone) rockcommon on outcrops, bluffs of Ogallala Forma…NW-facing hillside with a mixture of rock ty…Limestone outcrops by the roadCross Timbers and Prairies Ecological Region…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.5 °C 9.00–24.6

Seasonal swing summer↔winter21.5 °C

Max temp (day)19.8 °C 16.0–31.1

Min temp (night)7.70 °C 2.00–18.0

Precipitation53.8 mm/mo 12.0–127

Air humidity54.0 % 45.3–57.9

Moisture balance-29.1 mm/mo -112–15.3

Vapour deficit726 Pa 534–1,694

Wind speed3.10 m/s 1.70–5.40

Cloud cover39.1 % 17.8–43.8

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)