Psilotum nudum
(L.) P.Beauv. · speciesAt a glance
Occurrence records13 621
Data sources15
Biological traits33
DNA specimens52
eDNA detections42
Sources15 archives
Databases and archives Psilotum nudum's data was compiled from.
WikipediaWikimedia Foundation9 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility13 602 records↗
OBISOcean Biodiversity Information System19 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI42 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics52 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources33 traits
Chemical compositionLOTUS · NPASS156 compounds
Occurrence & distributionGBIF · OBIS13 621 records
Environmental DNA1 datasets · 3 countries42 detections
DNA & barcodingBOLD · NCBI52 specimens
Genome at a glanceCCDB · GoaT60.1 Gbp
01Narrative
Psilotum nudum, the whisk fern, is a fernlike plant. Like the other species in the order Psilotales, it lacks roots. Its name, Psilotum nudum, means "bare naked" in Latin, because it lacks (or seems to lack) most of the organs of typical vascular plants, as a result of evolutionary reduction. (Note that leaves are not actually absent, but greatly reduced.)
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology6
Leaf length1.75 mm
Leaf length max850 mm
Leaf length min100 mm
Plant height0.6 m
Plant height max0.6 m
Plant height min0 m
Life cycle & reproduction9
Deciduousnessevergreen
Dispersal typewind
Flowering endJul
Flowering startMar
Life formperennial or epiphyte
Life spanperennial
Pollination syndromeabiotic
Raunkiær life formchamaephyte
Resprouting capacityfire_killed
Diet & foraging1
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatewet tropical
Climberself-supporting
Elevation max1 500 m
Elevation mean375 m
Elevation min0 m
Epiphyteobligatory
Growth formherb
Habitat GIFTBosque alto
Leaf compoundnesssimple
Leaf shapeterete
Succulenceno
Woodinessnon-woody
Physiology & chemistry3
Leaf p0.761 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Other traits1
Shoot orientationerect
03Chemical composition156 compounds
Compounds documented for Psilotum nudum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavonols9
Chalcones9
Cinnamic acids and derivatives8
Flavones7
Wax monoesters7
Documented compounds156 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Betulonic acid | present | NPASS | |
| (+)-Erythrodiol | present | NPASS | |
| (+)-Ursolic Acid | present | NPASS | |
| (+)-Yangambin | present | NPASS | |
| (-)-Clerosterol | present | LOTUS | |
| (-)-Isopulegol | present | NPASS | |
| (1R,2S,4R)-2-Hydroxy-alpha,alpha,4-trimethylcyclohexanemethanol | present | NPASS | |
| (1R,4S,4aR,7S,8aR)-1,6-dimethyl-4-propan-2-yl-3,4,4a,7,8,8a-hexahydro-2H-naphthalene-1,7-diol | present | NPASS | |
| (1S,2S,20S,42S,46R)-7,8,9,12,13,14,25,26,27,30,31,32,35,36,37,46-hexadecahydroxy-3,18,21,41,43-pentaoxanonacyclo[27.13.3.138,42.02,20.05,10.011,16.023,28.033,45.034,39]hexatetraconta-5,7,9,11,13,15,23,25,27,29(45),30,32,34(39),35,37-pentadecaene-4,17,22,40,44-pentone | present | NPASS | |
| (2e)-7-Phenylhepta-2-en-4,6-diyn-1-yl acetate | present | NPASS |
05DNA & barcoding52 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psilotum nudum has left across the world's sequence archives.
At a glance
DNA specimens52
Marker genes6
GenBank sequences10
eDNA detections42
Countries4
The DNA barcodea real sequence read deposited for this species
TTGACCTATTATACCCCTGATTATAAAGTCAGTGATACTGATATCCTAGCAGCATTTCGAGTGACTCCTCAACCTGGAGTACCACCTGAG …
Psilotum nudum voucher Canek Ledesma 20102 (MEXU, US) ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL10★rbcLa★ITStrnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Psilotum nudum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size60 117 660 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
WHEAT17 Gb
THIS GENOME Psilotum nudum60.12 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 208 n = 104
Ploidy4× tetraploid · measured
Chromosome records96–2122n range208median208mode16records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2088×GoaT · Kew Plant DNA C-values Database · CCDB · new-zealand · CCDB · book-ipcn65 +2
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · new-zealand
CCDB · book-ipcn65 — Abraham & N. 1965
CCDB · book-LoveLove1977 — Okabe 1929
CCDB · book-LoveLove1977 — Ninan 1956a
CCDB · book-LoveLove1977 — Abraham & Ninan 1965
CCDB · book-LoveLove1977 — Mitui 1973
CCDB · Cave1956 — Ninan a
2n 1045×CCDB · croinout · CCDB · ipcn-api-dl · CCDB · book-LoveLove1977
CCDB · croinout — Solis, P. S. & Solis, D. E. 1988
CCDB · ipcn-api-dl — Soltis, P. S. & D. E. Soltis. 1988. Electrophoretic evidence for genetic diploidy in Psilotum nudum. Amer. J. Bot. 75: 1667–1671.
CCDB · book-LoveLove1977 — Okabe 1929
CCDB · book-LoveLove1977 — Manton (in Ninan 1956a)
CCDB · book-LoveLove1977 — Ninan 1956a
2n 961×CCDB · book-LoveLove1977
CCDB · book-LoveLove1977 — Guignard 1894
2n 1001×CCDB · book-LoveLove1977
CCDB · book-LoveLove1977 — Meyer, C. 1928
2n 2121×CCDB · croinout
CCDB · croinout — Mahabale, T. S. & Kamble, S. Y. 1981
n 1046×CCDB · croinout · CCDB · book-ipcn65 · CCDB · ipcn-api-dl +2
CCDB · croinout — Mitui, K. 1973
CCDB · croinout — Ghatak, J. 1977
CCDB · book-ipcn65 — Abraham & N. 1965
CCDB · ipcn-api-dl — GHATAK, J. 1977. Biosystematic survey of pteridophytes from Shevaroy Hills, south India. Nucleus 20: 105–108.
CCDB · book-ipcn75-78 — Ghatak 1977
CCDB · book-ipcn73-74 — MITUI, K. 1973. A cytological survey on the Pteridophytes of the Bon Islands. J. Jap. Bot. 48: 247-253.
n 525×CCDB · croinout · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +1
CCDB · croinout — Sahashi, N. 1980
CCDB · croinout — Mitui, K. 1976
CCDB · ipcn-api-dl — Mitui, K. 1976a. Chromosome numbers of some ferns in the Ryukyu Islands. J. Jap. Bot. 51: 33–41.
CCDB · book-ipcn75-78 — Mitui 1976a
CCDB · eflora
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
08Occurrence & distribution
Record type13 621 records
Wild obs. + sensor9 661
Museum / vouchered3 848
Cultivated / captive2
Fossil2
Other108
Origin
Native322
Introduced1
Range
Area of Occupancy AOO22 932 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy84% within 1 km
≤100 m 6 167≤1 km 714≤10 km 717>10 km 614
8 212 georeferenced · 1 449 without coordinates
Open the mapobservation + sensor9 661
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy25% within 1 km
≤100 m 164≤1 km 168≤10 km 842>10 km 149
1 323 georeferenced · 2 525 without coordinates
Open the institutions mapphysical evidence3 848
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 2 records without
Open the mapnot free-living2
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions138 of 266 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Tsukuba, JP | 323 |
| Auckland, NZ | 187 |
| Brisbane, AU | 171 |
| Bronx, US | 146 |
| Saint Louis, US | 141 |
| Mount Annan, AU | 135 |
| Wellington, NZ | 118 |
| Canberra, AU | 117 |
| Museo Entomologico de Leonlocation not on record | 113 |
| Paris, FR | 94 |
| Chicago, US | 82 |
| Tampa, US | 77 |
| Kew, GB | 71 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 66 |
| Nishihara, JP | 55 |
| Christchurch, NZ | 54 |
| Miami, US | 49 |
| Chengdu, CN | 48 |
| Palmerston, AU | 47 |
| University of Stellenboschlocation not on record | 47 |
| Instituto de Ecología y Sistemáticalocation not on record | 47 |
| Taipei, TW | 46 |
| Corrientes, AR | 43 |
| Viña del Mar, CL | 41 |
| UNESP, Campus São José Rio Prêtolocation not on record | 36 |
| BISHlocation not on record | 35 |
| Pretoria, ZA | 33 |
| Beijing, CN | 29 |
| South Kensington, GB | 28 |
| Honolulu, US | 28 |
| National Museum of Natural Sciencelocation not on record | 26 |
| Chapel Hill, US | 26 |
| Armidale, AU | 25 |
| Philadelphia, US | 23 |
| Smithfield, AU | 23 |
| Salvador, BR | 22 |
| Kensington, AU | 22 |
| Durban, ZA | 21 |
| Minia, EG | 21 |
| Yunnan Universitylocation not on record | 20 |
| Guangzhou, CN | 20 |
| Burlington, US | 19 |
| Puerto Ayora, EC | 19 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 19 |
| Blumenau, BR | 18 |
| Durango, MX | 18 |
| Guilin, CN | 17 |
| Adelaide, AU | 17 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 17 |
| WTUlocation not on record | 17 |
| HNBlocation not on record | 15 |
| McWane Science Centerlocation not on record | 14 |
| UFBAlocation not on record | 14 |
| LDlocation not on record | 14 |
| National Biodiversity Institute, Costa Ricalocation not on record | 14 |
| Riverside, US | 13 |
| Rotorua, NZ | 11 |
| Hobart, AU | 11 |
| Taipei, TW | 11 |
| James Cook Townsvillelocation not on record | 11 |
| Fort Worth, US | 11 |
| UFMSlocation not on record | 10 |
| San Isidro, AR | 10 |
| TAIElocation not on record | 10 |
| Cape Town, ZA | 10 |
| JBRJlocation not on record | 10 |
| UnBlocation not on record | 10 |
| Irvine, US | 9 |
| Knoxville, US | 9 |
| Kunming, CN | 9 |
| TNMlocation not on record | 9 |
| Santa Cruz de la Sierra, BO | 9 |
| Seychelles National Herbariumlocation not on record | 9 |
| John T. Waterhouse Herbariumlocation not on record | 9 |
| Zhejiang Universitylocation not on record | 9 |
| Vancouver, CA | 8 |
| UFMGlocation not on record | 8 |
| Plocation not on record | 8 |
| UFPRlocation not on record | 8 |
| Université de Bordeauxlocation not on record | 8 |
| Austin, US | 8 |
| Universidade Federale do Rio Grande do Sullocation not on record | 7 |
| WAGlocation not on record | 7 |
| US | 7 |
| Guiyang, CN | 6 |
| Chongqing Museumlocation not on record | 6 |
| Ann Arbor, US | 6 |
| Laboratorio de Ictiologialocation not on record | 6 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 6 |
| Canadian Department of Agriculturelocation not on record | 6 |
| HAWlocation not on record | 6 |
| Calabar, NG | 6 |
| Claremont, US | 5 |
| CASlocation not on record | 5 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 5 |
| IECOSlocation not on record | 5 |
| Olocation not on record | 5 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 5 |
| Guatemala City, GT | 4 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 4 |
| Jena Microbial Resource Collectionlocation not on record | 4 |
| Wlocation not on record | 4 |
| Turku, FI | 4 |
| Universiti Sains Malaysialocation not on record | 4 |
| LBVlocation not on record | 4 |
| Montréal, CA | 4 |
| UNEMATlocation not on record | 4 |
| Herbier National du Gabonlocation not on record | 4 |
| Brasília, BR | 4 |
| Berlin, DE | 4 |
| Bloomington, US | 4 |
| Parkville, AU | 4 |
| Université de Strasbourglocation not on record | 4 |
| Moscow State Universitylocation not on record | 4 |
| San Diego, US | 4 |
| MeiseBGlocation not on record | 4 |
| IAPlocation not on record | 3 |
| UTFPR-SLlocation not on record | 3 |
| Shanghai, CN | 3 |
| Jurica-Suchy Nature Museumlocation not on record | 3 |
| Xiamen, CN | 3 |
| Wuhan, CN | 3 |
| GAlocation not on record | 3 |
| KR | 3 |
| Antiguo Cuscatlán, SV | 3 |
| Feira de Santana, BR | 3 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 3 |
| Cenargenlocation not on record | 3 |
| Wuhan, CN | 3 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 3 |
| Ischia Marine Centrelocation not on record | 3 |
| Córdoba, AR | 3 |
| St. Augustine, TT | 3 |
| UTFPR-CPlocation not on record | 3 |
| UFAClocation not on record | 3 |
| Boise, US | 3 |
| Bangkok, TH | 3 |
| UNESP-RClocation not on record | 3 |
| CEPLAClocation not on record | 3 |
| Uppsala, SE | 3 |
| Lake Charles, US | 3 |
| Pullman, US | 2 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 2 |
| Nanjing, CN | 2 |
| Frankfurt am Main | 2 |
| Campo Mourão, BR | 2 |
| La Paz, BO | 2 |
| GB | 2 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 2 |
| Millersville, US | 2 |
| Morgantown, US | 2 |
| Cambridge University Herbariumlocation not on record | 2 |
| Fredericksburg, US | 2 |
| Moscow, US | 2 |
| INMAlocation not on record | 2 |
| UFESlocation not on record | 2 |
| Santa Teresa, BR | 2 |
| Masindi, UG | 2 |
| Guiyang, CN | 2 |
| Texas Lutheran Universitylocation not on record | 2 |
| Jataí / Setor Industrial, BR | 2 |
| ASUlocation not on record | 2 |
| Foz do Iguaçu, BR | 2 |
| US | 2 |
| Pontifícia Universidade Católica do Paranálocation not on record | 2 |
| Corvallis, US | 2 |
| Pontifícia Universidade Católica do Paranálocation not on record | 2 |
| Smithsonian Institution, National Museum of Natural Historylocation not on record | 2 |
| Quito, EC | 2 |
| MAlocation not on record | 2 |
| UFRRJlocation not on record | 2 |
| Los Angeles, US | 2 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 2 |
| Chongqing Natural History Museumlocation not on record | 1 |
| UFSClocation not on record | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| Badajoz, ES | 1 |
| Seoul, KR | 1 |
| Chengdu, CN | 1 |
| Guiyang, CN | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Provo, US | 1 |
| Logan, US | 1 |
| UEMAlocation not on record | 1 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 1 |
| North Carolina Zoological Parklocation not on record | 1 |
| Nagasaki University - Fisherieslocation not on record | 1 |
| Paleontological Collectionlocation not on record | 1 |
| Madison, US | 1 |
| Santa Barbara, US | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Hangzhou, CN | 1 |
| Bogotá, D.C., CO | 1 |
| UNESP-FCAlocation not on record | 1 |
| Vietnam National Museum of Naturelocation not on record | 1 |
| Cascavel, BR | 1 |
| Nanchong, CN | 1 |
| Universidade Federal de Sergipe (UFS)location not on record | 1 |
| BAYLUlocation not on record | 1 |
| San Francisco, US | 1 |
| USP-IBlocation not on record | 1 |
| Museo Athanasius Kircher di Romalocation not on record | 1 |
| New Brunswick, US | 1 |
| Pondicherry, IN | 1 |
| Universidad Nacional Federico Villarreallocation not on record | 1 |
| Long Beach, US | 1 |
| Institut Botanique Ake-Assi d'Andokoilocation not on record | 1 |
| UNESP-IBILCElocation not on record | 1 |
| Lima, PE | 1 |
| UTFPR-DVlocation not on record | 1 |
| Jackson, US | 1 |
| EL PASO, US | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| Lubbock, US | 1 |
| LNBG$location not on record | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
| Turlock, US | 1 |
| IEBlocation not on record | 1 |
| Brookings, US | 1 |
| Universität Göttingenlocation not on record | 1 |
| Vietnam Academy of Science and Technology (VAST)location not on record | 1 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 1 |
| Ilhéus, BR | 1 |
| Denver, US | 1 |
| Flagstaff, US | 1 |
| Cuiabá, BR | 1 |
| UFRPElocation not on record | 1 |
| Batemans Bay, AU | 1 |
| Palmerston North, NZ | 1 |
| University of Alberta Museumslocation not on record | 1 |
| UNICAMPlocation not on record | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| Wuzhou, CN | 1 |
| BRNUlocation not on record | 1 |
| Barcelona, ES | 1 |
| UEMlocation not on record | 1 |
| Brasília, BR | 1 |
| Federal University of Espírito Santolocation not on record | 1 |
| Universidade Federal do Espírito Santolocation not on record | 1 |
| Whitehorse, CA | 1 |
| Mishler Lablocation not on record | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 1 |
| BMlocation not on record | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Portland, US | 1 |
| Université National du Béninlocation not on record | 1 |
| Universidad Nacional de Colombia (UNAL)location not on record | 1 |
| Muséum National d'Histoire Naturellelocation not on record | 1 |
| Mississippi State, US | 1 |
| Fullerton, US | 1 |
| Santarém, BR | 1 |
| Cheney, US | 1 |
| HUT Culture Collectionlocation not on record | 1 |
| Québec, CA | 1 |
| Museo de Historia Natural de El Salvadorlocation not on record | 1 |
| Provincia di Livornolocation not on record | 1 |
| Stockholm, SE | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| Universidad Nacional de Asunciónlocation not on record | 1 |
| IBANNlocation not on record | 1 |
| Llocation not on record | 1 |
| TAFORI-LSRClocation not on record | 1 |
| Alicante, ES | 1 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 1 |
| Davis, US | 1 |
266 institutions · 3 639 of 3 848 vouchered records shown · 188 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA42 detections
Where the DNA of Psilotum nudum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found42
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 42 detections have coordinates
Open the map3 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median7.60 °C 7.40–20.9
Seasonal swing summer↔winter25.4 °C
Max temp (day)11.2 °C 9.60–22.9
Min temp (night)3.70 °C 3.00–19.3
Precipitation253 mm/mo 122–344
Air humidity63.3 % 58.9–64.9
Moisture balance263 mm/mo
Vapour deficit439 Pa 428–1,062
Wind speed3.40 m/s
Cloud cover44.6 % 26.3–47.5
CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.