Psilocybe yungensis

Singer & A.H.Sm. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Hymenogastraceae/Psilocybe

At a glance

Occurrence records103

Data sources8

Biological traits0

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Psilocybe yungensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility103 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF103 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Psilocybe yungensis is a species of psychedelic mushroom in the family Hymenogastraceae. In North America, it is found in northeast, central and southeastern Mexico. In South America, it has been recorded from Bolivia, Colombia, and Ecuador. It is also known from the Caribbean island Martinique, and China. The mushroom grows in clusters or groups on rotting wood. The fruit bodies have conical to bell-shaped reddish- to orangish-brown caps that are up to 2.5 cm in diameter, set atop slender stems 3 to long. The mushrooms stain blue when bruised, indicative of the presence of the compound psilocybin. Psilocybe yungensis is used by Mazatec Indians in the Mexican State of Oaxaca for entheogenic purposes.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psilocybe yungensis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences8

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKP686214.1 ↗200 bp

ACGT

TTTTACATACCCCAAATGTAATAGAATGTATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATG …

Psilocybe yungensis voucher ICN 154713 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS8

fungal barcode

08Occurrence & distribution

Record type103 records

Wild obs. + sensor95

Museum / vouchered8

Range

Area of Occupancy AOO320 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy49% within 1 km

≤100 m 27≤1 km 13≤10 km 12>10 km 29

81 georeferenced · 14 without coordinates

Open the mapobservation + sensor95

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durango, MX	3
Chicago, US	2
Bronx, US	1
Universidade Federale do Rio Grande do Sullocation not on record	1

4 institutions · 7 of 8 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Psilocybe yungensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 15.7–15.7

Seasonal swing summer↔winter9.60 °C

Max temp (day)22.0 °C

Min temp (night)9.00 °C

Precipitation34.7 mm/mo

Air humidity50.9 %

Moisture balance-93.3 mm/mo

Vapour deficit884 Pa

Wind speed4.10 m/s

Cloud cover25.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)