Psilocybe weraroa — The Life Data

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Hymenogastraceae/Psilocybe

At a glance

Occurrence records567

Data sources7

Biological traits0

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Psilocybe weraroa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility567 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF567 records

DNA & barcodingNCBIsequences

01Narrative

Psilocybe weraroa (formerly Weraroa novae-zelandiae) is a secotioid fungus in the family Hymenogastraceae. It is endemic to New Zealand. This species is closely related to Psilocybe cyanescens and is in the Cyanescens phylogenetic clade. As a bluing member of the genus Psilocybe it contains the psychoactive compounds psilocin and psilocybin.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psilocybe weraroa has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPV389892.1 ↗721 bpNew Zealand · 2023

ACGT

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAACTTTGGCGTGGTTG …

Psilocybe weraroa strain ICMP 25050 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS2

fungal barcode

08Occurrence & distribution

Record type567 records

Wild obs. + sensor545

Museum / vouchered18

Cultivated / captive4

Range

Area of Occupancy AOO1 456 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy51% within 1 km

≤100 m 123≤1 km 120≤10 km 67>10 km 167

477 georeferenced · 68 without coordinates

Open the mapobservation + sensor545

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 2≤1 km 1≤10 km 1

4 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence18

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	15
Chapel Hill, US	1
Canberra, AU	1

3 institutions · 17 of 18 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.