Psilocybe subaeruginosa

Cleland · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Hymenogastraceae/Psilocybe

At a glance

Occurrence records4 394

Data sources12

Biological traits0

DNA specimens2

eDNA detections8

Sources12 archives

Databases and archives Psilocybe subaeruginosa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 394 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS7 compounds

Occurrence & distributionGBIF4 394 records

Environmental DNA2 datasets · 3 countries8 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceGoaT · NCBI≈59 Mbp

01Narrative

Psilocybe subaeruginosa is a species of agaric fungus in the family Hymenogastraceae described in 1927 and known from Australia and New Zealand. As a blueing member of the genus Psilocybe it contains the psychoactive compounds psilocin and psilocybin.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition7 compounds

Compounds documented for Psilocybe subaeruginosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Simple indole alkaloids1

Acetate-derived alkaloids $ Polyamines1

Naphthoquinones1

Fatty aldehydes1

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
[3-[2-(dimethylazaniumyl)ethyl]-1H-indol-4-yl] hydrogen phosphate	present	LOTUS
MSWZFWKMSRAUBD-RXRWUWDJSA-N	present	NPASS
Putresine	present	NPASS
RKJUIXBNRJVNHR-UHFFFAOYSA-N	present	NPASS
Succinic acid semialdehyde	present	NPASS
TVTGZVYLUHVBAJ-RDQKPOQOSA-N	present	NPASS
WS-5995 B	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psilocybe subaeruginosa has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences9

eDNA detections8

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKC669296.1 ↗597 bpNew Zealand · 2008

ACGT

TTTCCGTAGGTGAACNTGCGGAAGGATCATTATTGAATAACTTTGGCGTGGTTGTAGCTGGTCCTCTCGGGGGCATGTGCTCGCCTGTCA …

Psilocybe subaeruginosa voucher L.Taylor (PDD) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Psilocybe subaeruginosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈59 176 799 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Psilocybe subaeruginosa0.06 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type4 394 records

Wild obs. + sensor4 221

Museum / vouchered171

Cultivated / captive2

Origin

Native5

Range

Area of Occupancy AOO9 460 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 1 175≤1 km 631≤10 km 272>10 km 1 516

3 594 georeferenced · 627 without coordinates

Open the mapobservation + sensor4 221

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 14≤1 km 74≤10 km 36>10 km 1

125 georeferenced · 46 without coordinates

Open the institutions mapphysical evidence171

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	52
Hobart, AU	45
DPIlocation not on record	22
Brisbane, AU	11
Canberra, AU	8
National Museums of Kenyalocation not on record	6
Kensington, AU	4
Adelaide, AU	4
Durham, US	2
NSW Dept of Planning, Industry and Environmentlocation not on record	2
TENN-Flocation not on record	1
Auckland, NZ	1

12 institutions · 158 of 171 vouchered records shown · 9 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA8 detections

Where the DNA of Psilocybe subaeruginosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys2

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.70 °C 2.50–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)9.20 °C 4.60–28.5

Min temp (night)1.40 °C 0.6–15.0

Precipitation50.9 mm/mo 15.6–130

Air humidity62.6 % 43.4–69.2

Moisture balance19.9 mm/mo -143–54.3

Vapour deficit357 Pa 225–1,624

Wind speed4.70 m/s 4.00–5.90

Cloud cover38.9 % 18.1–57.5

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Psilocybe subaeruginosa

At a glance

Sources12 archives

Compound class profile4 classes

Documented compounds7 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type4 394 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions7 of 12 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 394 records