Psilocybe silvatica

(Peck) Singer & A.H.Sm. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Hymenogastraceae/Psilocybe

At a glance

Occurrence records41

Data sources7

Biological traits0

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Psilocybe silvatica's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

GBIFGlobal Biodiversity Information Facility41 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF41 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Psilocybe silvatica is a psilocybin mushroom in the section Semilanceatae of the genus Psilocybe. Psilocybin is the main active compound. The species is closely related to its European twin Psilocybe medullosa, which differs genetically, and the American Psilocybe pelliculosa, which can be distinguished by spore size and cheilocystidia shape.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psilocybe silvatica has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY129362.1 ↗314 bp

ACGT

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATGAACTTGGCTCGGTTGCAGCTGGTCCTTTCGAGGGCATGTGCT …

Psilocybe silvatica 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4★ITS1

fungal barcode

08Occurrence & distribution

Record type41 records

Wild obs. + sensor8

Museum / vouchered33

Range

Area of Occupancy AOO136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy43% within 1 km

≤100 m 3≤10 km 2>10 km 2

7 georeferenced · 1 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 1≤1 km 4≤10 km 1>10 km 3

9 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence33

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Göteborg, SE	12
Joensuu, FI	6
WU-MYClocation not on record	3
Olocation not on record	2
Bernard Price Institute for Palaeontological Researchlocation not on record	2
Blacksburg, US	2
Bronx, US	1
Karlsruhe, DE	1

8 institutions · 29 of 33 vouchered records shown · 4 without an institution code

09Environmental DNA2 detections

Where the DNA of Psilocybe silvatica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)