Psilocybe medullosa

(Bres.) Borov. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Hymenogastraceae/Psilocybe

At a glance

Occurrence records292

Data sources9

Biological traits0

DNA specimens2

eDNA detections85

Sources9 archives

Databases and archives Psilocybe medullosa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility292 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI85 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF292 records

Environmental DNA2 datasets · 5 countries85 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Psilocybe medullosa is a species of psychoactive mushroom. It was originally described in 1898 as Naucoria medullosa by Italian mycologist Giacomo Bresadola. Czech mycologist Jan Borovička transferred it to Psilocybe in 2007. A widespread but rather rare species, it is found in Europe, where it grows as a saprobe on woody debris and detritus. Chemical analysis has been used to confirm the presence of the psychedelic compounds psilocin and psilocybin in the fruit bodies but probably at low levels. Psilocybe silvatica is its American sister species; it differs by subtle changes in molecular markers (LSU, ITS rDNA, and others).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psilocybe medullosa has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences7

eDNA detections85

Countries5

The DNA barcodea real sequence read deposited for this species

ITSHF912355.1 ↗261 bpAustria

ACGT

GCTGGTCCTTTCGAGGGCATGTGCTCGCCGTGTCATCTTTATCTCTCCACCTGTGCACGTTTTGTAGACCTGGATTAGTTAACTTTCCGA …

Psilocybe medullosa genomic DNA containing ITS1, 5.8S rRNA gene, strain P18, specimen voucher IB:81/470

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS7

fungal barcode

08Occurrence & distribution

Record type292 records

Wild obs. + sensor126

Museum / vouchered165

Other1

Range

Area of Occupancy AOO940 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy38% within 1 km

≤100 m 29≤1 km 10≤10 km 58>10 km 6

103 georeferenced · 23 without coordinates

Open the mapobservation + sensor126

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 38≤1 km 58≤10 km 20>10 km 7

123 georeferenced · 42 without coordinates

Open the institutions mapphysical evidence165

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	66
SLU Artdatabankenlocation not on record	8
Oulu, FI	5
Turku, FI	5
WU-MYClocation not on record	5
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	3
Olocation not on record	3
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	3
Salzburg, AT	2
IB FRC Komi SC UB RASlocation not on record	2
University of Oslo, Natural History Museumlocation not on record	1
Kuopio, FI	1
Kew, GB	1
Copenhagen, DK	1

14 institutions · 106 of 165 vouchered records shown · 59 without an institution code

09Environmental DNA85 detections

Where the DNA of Psilocybe medullosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found85

Studies independent surveys2

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 85 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.6 °C 5.60–16.6

Seasonal swing summer↔winter23.0 °C

Max temp (day)14.1 °C 8.10–19.8

Min temp (night)6.10 °C 3.20–13.7

Precipitation84.6 mm/mo 57.0–162

Air humidity64.2 % 56.8–68.2

Moisture balance29.8 mm/mo -41.9–57.3

Vapour deficit453 Pa 290–740

Wind speed3.20 m/s 2.30–6.40

Cloud cover46.7 % 40.0–59.8

CHELSA 1981–2010, ~9 km grid, at location & month of 85 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)