Psilocybe fimetaria — The Life Data

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Hymenogastraceae/Psilocybe

At a glance

Occurrence records385

Data sources7

Biological traits0

DNA specimens1

eDNA detections0

Sources7 archives

Databases and archives Psilocybe fimetaria's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility385 records↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF385 records

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Psilocybe fimetaria is a psilocybin mushroom, having psilocybin and psilocin as main active compounds.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psilocybe fimetaria has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences9

Countries7

The DNA barcodea real sequence read deposited for this species

ITSOR736247.1 ↗421 bpCanada · 2012

ACGT

GTTTTCATATACCCCAAAGTATGTAACAGAATGTATCATATGGCCTTGTGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGG …

Psilocybe fimetaria voucher F30923 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS9

fungal barcode

08Occurrence & distribution

Record type385 records

Wild obs. + sensor341

Museum / vouchered42

Other2

Range

Area of Occupancy AOO1 004 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy46% within 1 km

≤100 m 131≤1 km 14≤10 km 126>10 km 43

314 georeferenced · 27 without coordinates

Open the mapobservation + sensor341

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 3≤1 km 11>10 km 1

15 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence42

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Copenhagen, DK	10
Helsinki, FI	5
Tilburg, NL	3
SLU Artdatabankenlocation not on record	3
Philadelphia, US	2
Kew, GB	2
Göteborg, SE	2
BDBClocation not on record	1
Vancouver, CA	1
Bardejov, SK	1
Gijón, ES	1
San Sebastián, ES	1
LDlocation not on record	1

13 institutions · 33 of 42 vouchered records shown · 9 without an institution code