Psilocybe cubensis

(Earle) Singer · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Hymenogastraceae/Psilocybe

At a glance

Occurrence records2 964

Data sources11

Biological traits0

DNA specimens22

eDNA detections29

Sources11 archives

Databases and archives Psilocybe cubensis's data was compiled from.

WikipediaWikimedia Foundation13 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 964 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF2 964 records

Environmental DNA3 datasets · 5 countries29 detections

DNA & barcodingBOLD · NCBI22 specimens

Genome at a glanceGoaT · NCBI≈46 Mbp

01Narrative

Psilocybe cubensis is a species of psychedelic mushroom whose principal active compounds are psilocybin and psilocin. Commonly called shrooms, magic mushrooms, golden halos, cubes, or gold caps, it belongs to the fungus family Hymenogastraceae and was previously known as Stropharia cubensis. It is the most well known psilocybin mushroom due to its wide distribution and ease of cultivation.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition4 compounds

Compounds documented for Psilocybe cubensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Simple indole alkaloids3

Phenylethylamines $ Simple indole alkaloids1

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
[3-[2-(dimethylazaniumyl)ethyl]-1H-indol-4-yl] hydrogen phosphate	present	LOTUS
Baeocystin	present	LOTUS
Norpsilocin	present	LOTUS
Psilocin	present	LOTUS

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psilocybe cubensis has left across the world's sequence archives.

At a glance

DNA specimens22

Marker genes3

GenBank sequences10

eDNA detections29

Countries5

The DNA barcodea real sequence read deposited for this species

ITSPZ374699.1 ↗279 bpIsrael · 2024

ACGT

AAATTCTCAACCTTACCAGCTTTTGTTAGCTTGTGTAATGGCTTGGACTTGGGGGTTTATTTTGCCGGCTTCTTACCAAGTCAGCTCCCC …

Psilocybe cubensis isolate Jedi Mind Fck internal transcribed spacer 2 and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1★ITS2

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Psilocybe cubensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈46 389 424 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Psilocybe cubensis0.05 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness95.8% BUSCO

08Occurrence & distribution

Record type2 964 records

Wild obs. + sensor2 633

Museum / vouchered330

Other1

Range

Area of Occupancy AOO8 304 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy51% within 1 km

≤100 m 753≤1 km 367≤10 km 413>10 km 666

2 199 georeferenced · 434 without coordinates

Open the mapobservation + sensor2 633

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 121≤1 km 14≤10 km 59>10 km 8

202 georeferenced · 128 without coordinates

Open the institutions mapphysical evidence330

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zapopan, MX	69
Durango, MX	38
FLASlocation not on record	26
National Biodiversity Institute, Costa Ricalocation not on record	20
Brisbane, AU	19
Chicago, US	18
DPIlocation not on record	18
Mexico City, MX	14
WTUlocation not on record	11
Bronx, US	10
Baton Rouge, US	7
TENN-Flocation not on record	7
Philadelphia, US	6
Colorado State Universitylocation not on record	6
Universidad Juárez Autónoma de Tabascolocation not on record	6
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	5
Fungario QCAM de la Pontificia Universidad Católica del Ecuadorlocation not on record	4
Copenhagen, DK	4
National Museums of Kenyalocation not on record	4
Universidad de los Llanos (UniLlanos)location not on record	3
San Sebastián, ES	2
Durham, US	2
Bernard Price Institute for Palaeontological Researchlocation not on record	2
UFESlocation not on record	2
Denver, US	1
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	1
Pullman, US	1
Blacksburg, US	1
National Mushroom Centre, Department of Agriculture, Ministry of Agriculture and Livestock, Bhutanlocation not on record	1
Gijón, ES	1
Vancouver, CA	1
Zürich, CH	1
WU-MYClocation not on record	1
UFSClocation not on record	1

34 institutions · 313 of 330 vouchered records shown · 12 without an institution code

09Environmental DNA29 detections

Where the DNA of Psilocybe cubensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys3

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.5 °C 15.7–26.2

Seasonal swing summer↔winter3.90 °C

Max temp (day)27.2 °C 20.0–30.2

Min temp (night)19.4 °C 9.00–22.8

Precipitation134 mm/mo 49.5–252

Air humidity65.1 % 53.5–68.7

Moisture balance13.0 mm/mo -79.0–146

Vapour deficit1,003 Pa 625–1,237

Wind speed2.40 m/s 1.80–3.80

Cloud cover32.8 % 26.7–65.9

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Psilocybe cubensis

At a glance

Sources11 archives

Compound class profile2 classes

Documented compounds4 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 964 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 964 records