Psilocybe caerulescens

Murrill · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Hymenogastraceae/Psilocybe

At a glance

Occurrence records730

Data sources9

Biological traits0

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Psilocybe caerulescens's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility730 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF730 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Psilocybe caerulescens, also known as landslide mushroom ("derrumbe" in Spanish), is a psilocybin mushroom having psilocybin and psilocin as main active compounds. Along with Psilocybe mexicana and Psilocybe aztecorum, it is one of the mushrooms likely to have been used by the Aztecs and is currently used by Mazatec shamans for its entheogenic properties.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psilocybe caerulescens has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences10

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMH862118.1 ↗585 bp

ACGT

ATCATTATTGAATGAACTTGACTTGGTTGTAGCTGGTCCTCTCGGGGACATGTGCTCGCCTTGTCATCTTTATCTATCCACCTGTGAACC …

Psilocybe caerulescens strain CBS 837.87 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type730 records

Wild obs. + sensor706

Museum / vouchered24

Range

Area of Occupancy AOO2 164 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy4% within 1 km

≤100 m 8≤1 km 18≤10 km 77>10 km 570

673 georeferenced · 33 without coordinates

Open the mapobservation + sensor706

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1≤1 km 2≤10 km 3

6 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence24

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durango, MX	6
Davis and Elkins Collegelocation not on record	5
Chicago, US	3
National Biodiversity Institute, Costa Ricalocation not on record	2
Zapopan, MX	1
Bronx, US	1
TENN-Flocation not on record	1
WTUlocation not on record	1
Fungario QCAM de la Pontificia Universidad Católica del Ecuadorlocation not on record	1
Baton Rouge, US	1

10 institutions · 22 of 24 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Psilocybe caerulescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 15.7–15.7

Seasonal swing summer↔winter9.60 °C

Max temp (day)22.0 °C

Min temp (night)9.00 °C

Precipitation34.7 mm/mo

Air humidity50.9 %

Moisture balance-93.3 mm/mo

Vapour deficit884 Pa

Wind speed4.10 m/s

Cloud cover25.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)