Psilocybe baeocystis

Singer & A.H.Sm. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Hymenogastraceae/Psilocybe

At a glance

Occurrence records100

Data sources7

Biological traits0

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Psilocybe baeocystis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility100 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS26 compounds

Occurrence & distributionGBIF100 records

DNA & barcodingNCBIsequences

01Narrative

Psilocybe baeocystis is a psilocybin mushroom of the family Hymenogastraceae. It contains the hallucinogenic compounds psilocybin, psilocin and baeocystin. The species is commonly known by various names such as bottle caps, knobby tops, blue bells, olive caps.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition26 compounds

Compounds documented for Psilocybe baeocystis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Aspidosperma type18

Corynanthe type5

Simple indole alkaloids2

Documented compounds26 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,9R,16R,17S,21R)-2,12-diazahexacyclo[14.2.2.19,12.01,9.03,8.016,21]henicosa-3,5,7,14-tetraen-17-ol	present	NPASS
(1S,4R,12S,13R,20R)-5,16-diazahexacyclo[11.6.1.11,4.04,12.06,11.016,20]henicosa-6,8,10-trien-2-one	present	NPASS
16-Epikopsinine	present	NPASS
16-Epipleiocarpamine	present	NPASS
2H-2,7a-Methanoindolo[2,3-a]quinolizine-13-carboxylic acid, 13-[(acetyloxy)methyl]-3-ethylidene-1,3,4,6,7,12b-hexahydro-, methyl ester, (2S,3E,5S,7aS,12bS,13R)-	present	NPASS
Baeocystin	present	LOTUS
dimethyl (1S,9R,13S,16R,17R,18R,21R)-13-[(1S,9R,16R,17R,18R,21R)-17,18-dihydroxy-4-methoxy-2,18-bis(methoxycarbonyl)-2,12-diazahexacyclo[14.2.2.19,12.01,9.03,8.016,21]henicosa-3(8),4,6,14-tetraen-14-yl]-17,18-dihydroxy-4-methoxy-2,12-diazahexacyclo[14.2.2.19,12.01,9.03,8.016,21]henicosa-3(8),4,6,14-tetraene-2,18-dicarboxylate	present	NPASS
dimethyl (1S,9R,16R,17R,18R,21R)-17,18-dihydroxy-2,12-diazahexacyclo[14.2.2.19,12.01,9.03,8.016,21]henicosa-3,5,7,14-tetraene-2,18-dicarboxylate	present	NPASS
dimethyl (1S,9R,16R,17R,18R,21R)-17,18-dihydroxy-4,5-dimethoxy-2,12-diazahexacyclo[14.2.2.19,12.01,9.03,8.016,21]henicosa-3(8),4,6,14-tetraene-2,18-dicarboxylate	present	NPASS
dimethyl (1S,9R,16R,17R,18R,21R)-5,17,18-trihydroxy-4-methoxy-2,12-diazahexacyclo[14.2.2.19,12.01,9.03,8.016,21]henicosa-3(8),4,6,14-tetraene-2,18-dicarboxylate	present	NPASS

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psilocybe baeocystis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMH211419.1 ↗611 bpUSA · 2012

ACGT

GAGGGCATGTGCTCGCCGTGTCATCTTTATCTCTCCACCTGTGCACCTTTTGTAGACCTGGATTAGTTAACTTTCCGAGGAAACTCGGTC …

Psilocybe baeocystis voucher Mushroom Observer # 109871 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

08Occurrence & distribution

Record type100 records

Wild obs. + sensor80

Museum / vouchered19

Cultivated / captive1

Range

Area of Occupancy AOO264 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy9% within 1 km

≤100 m 2≤1 km 5≤10 km 36>10 km 36

79 georeferenced · 1 without coordinates

Open the mapobservation + sensor80

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤1 km 4≤10 km 4>10 km 2

10 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence19

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WTUlocation not on record	10
Vancouver, CA	8

2 institutions · 18 of 19 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)