Psilocybe alutacea — The Life Data

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Hymenogastraceae/Psilocybe

At a glance

Occurrence records203

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Psilocybe alutacea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility203 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF203 records

DNA & barcodingNCBIsequences

01Narrative

Psilocybe alutacea is a species of agaric fungus in the family Hymenogastraceae. It was described in 2006 and is known from Australia and New Zealand. It is corprophilous, growing on animal dung. The fruitbodies have a small conical or convex cap, subdistant gills with an adnate attachment, a slender brown stipe and a faint blueing reaction to damage. As a blueing member of the genus Psilocybe it contains the psychoactive compounds psilocin and psilocybin.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psilocybe alutacea has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSPP414151.1 ↗649 bp

ACGT

CATTATTGAATGAACTTGGCTCGGTTGCAGCTGGTCCTCTCGAGGGCATGTGCTCGCCGTGTCATCTTTATCTCTCCACCTGTGCACCTT …

Psilocybe alutacea voucher 160523907 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type203 records

Wild obs. + sensor197

Museum / vouchered6

Range

Area of Occupancy AOO644 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy32% within 1 km

≤100 m 37≤1 km 15≤10 km 14>10 km 95

161 georeferenced · 36 without coordinates

Open the mapobservation + sensor197

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 6

6 georeferenced

Open the institutions mapphysical evidence6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Hobart, AU	6

1 institutions · 6 of 6 vouchered records shown