Psidium guajava
speciesAt a glance
Occurrence records45 847
Data sources20
Biological traits151
DNA specimens71
eDNA detections61
Sources20 archives
Databases and archives Psidium guajava's data was compiled from.
WikipediaWikimedia Foundation21 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility45 465 records↗
OBISOcean Biodiversity Information System382 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI61 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics71 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
FooDBThe Metabolomics Innovation Centrecompounds↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources151 traits
Chemical compositionDukesPhytochem · FooDB · LOTUS · NPASS6 343 compounds
Occurrence & distributionGBIF · OBIS45 847 records
Environmental DNA5 datasets · 8 countries61 detections
DNA & barcodingBOLD · NCBI71 specimens
Genome at a glanceCCDB · GIFT · GoaT465 Mbp
01Narrative
Flower Leafbud Common guava seedling, 14 months Psidium guajava, the common guava, yellow guava, lemon guava, or apple guava is an evergreen shrub or small tree native to the Caribbean, Central America and South America. It is easily pollinated by insects; when cultivated, it is pollinated mainly by the common honey bee, Apis mellifera.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsUSDATRY
Size & morphology28
Fruit length55 mm
Fruit length max80 mm
Fruit length min30 mm
Fruit width57.5 mm
⚠ sources differ — AusTraits: 57.5 mm · GIFT: 35 mm
Fruit width max50 mm
Fruit width min30 mm
Leaf length95 mm
⚠ sources differ — AusTraits: 95 mm · GIFT: 90 mm
Leaf length max165 mm
Leaf length min45 mm
Leaf mass347 mg
Leaf mass per area94.32 g/m2
Leaf size1 125 mm²
⚠ sources differ — TRY: 1 125 mm² · AusTraits: 3 622 mm²
Leaf width52.5 mm
⚠ sources differ — AusTraits: 52.5 mm · GIFT: 60 mm
Leaf width max85 mm
Leaf width min30 mm
Petiole length0.75 cm
Plant height10.65 m
⚠ sources differ — GIFT: 10.65 m · AusTraits: 8 m · USDA: 7.62 m · TRY: 8 m
Plant height max10 m
Plant height min3 m
Seed length2.8 mm
⚠ sources differ — TRY: 2.8 mm · AusTraits: 3 mm
Seed length max6 mm
Seed length min1 mm
Seed mass9 mg
⚠ sources differ — TRY: 9 mg · AusTraits: 1.7 mg · GIFT: 10.93 mg
Seed mass max12.62 mg
Seed mass min7.35 mg
Seed volume37.4 mm³
Seed volume max91 mm³
Seed volume min16 mm³
Life cycle & reproduction34
Bloom periodSpring
Coppice potentialNo
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typeanimal
Flower colourwhite
Flower conspicuousNo
Flower length max15 mm
Flower length min10 mm
Flowering timeynnnnnnyyyyy
Fruit seed period beginSummer
Fruit seed period endSummer
Growth rate USDAModerate
Life formtree
Life spanperennial
Lifespan categoryLong
Pollination modebiotic
Pollination syndromebeetle
⚠ sources differ — AusTraits: beetle · GIFT: insect
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsYes
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formphanerophyte
Resprout abilityYes
Resprouting capacityresprouts
Seed spread rateModerate
Seedling vigorMedium
Self fertilizationpresent
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment34
Active growth periodYear Round
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climateseasonally dry tropical
Climberself-supporting
Elevation max2 040 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterModerate
Foliage textureMedium
Fruit colouryellow
Fruit fleshinessfleshy
Fruit typeberry
Growth formtree
Growth form USDASingle Stem
Habitat GIFTCerrado
Hedge toleranceMedium
Known allelopathNo
Leaf compoundnesssimple
Leaf formelliptic
Leaf retentionYes
Leaf shapeelliptical oblong
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min36 in
Shape and orientationErect
Small grainNo
Succulenceno
Woodinesswoody
Physiology & chemistry29
Anaerobic toleranceLow
C:N ratioMedium
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementMedium
Fire resistantNo
Fire toleranceMedium
Frost free days min365 days
Ldmc max426 mg/g
Ldmc min426 mg/g
Leaf C:N ratio34.26 g/g
Leaf c470 mg/g
Leaf dry-matter content (LDMC)394 mg/g
⚠ sources differ — TRY: 394 mg/g · GIFT: 426 mg/g
Leaf n16.91 mg/g
Leaf p1.86 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max150 in
Precipitation min40 in
Salinity toleranceMedium
Shade toleranceMedium
Soil pH max7 pH
Soil pH min5.5 pH
Specific leaf area (SLA)10.24 mm²/mg
Temperature min33 °F
Wood density657 mg/cm³
⚠ sources differ — TRY: 657 mg/cm³ · GIFT: 706 mg/cm³
Uses & economy15
Berry nut seed productYes
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable browse animalLow
Palatable graze animalLow
Palatable humanYes
Post productNo
Pulpwood productNo
Seeds per pound36 200 per lb
ToxicityNone
Veneer productNo
Other traits10
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousYes
Fruit seed persistenceYes
Height at 20yr7.62 m
Leaf marginentire
Leaf spinesno
Leaf thornsno
Planting density max400 per acre
Planting density min100 per acre
03Chemical composition6 343 compounds
Compounds documented for Psidium guajava across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingFruits
Compound class profile5 classes
Aminoacids138
Gallotannins80
Glycerophospholipids57
Flavonols52
Cinnamic acids and derivatives47
Documented compounds6 343 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| CARBOHYDRATES | 901,000 ppm | DukesPhytochem | |
| WATER | 868,000 ppm | DukesPhytochem | |
| FIBER | 424,000 ppm | DukesPhytochem | |
| ALPHA-PINENE | 378,000 ppm | DukesPhytochem | |
| TANNIN | 300,000 ppm | DukesPhytochem | |
| ETHYL-ACETATE | 262,000 ppm | DukesPhytochem | |
| ETHANOL | 258,000 ppm | DukesPhytochem | |
| HEXANOIC-ACID-ETHYL-ESTER | 155,000 ppm | DukesPhytochem | |
| PROTEIN | 152,000 ppm | DukesPhytochem |
05DNA & barcoding71 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psidium guajava has left across the world's sequence archives.
At a glance
DNA specimens71
Marker genes8
GenBank sequences7
eDNA detections61
Countries9
The DNA barcodea real sequence read deposited for this species
GAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCCAAGCAGAATGACCAGAGAACTC …
Psidium guajava voucher Costa, sn small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK1★rbcL5★rbcLa★trnL★ITS1★ITS2trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT · GoaT · NCBI
The complete instruction manual Psidium guajava carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size464 550 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Psidium guajava0.46 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 22 n = 11
Ploidy2× diploid · measured
Chromosome records22–442n range22median22mode24records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2218×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +5
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ipcn-api-dl — Vijayakumar, N. & D. Subramanian. 1985. Cytotaxonomical studies in south Indian Myrtaceae. Cytologia 50: 513–520.
CCDB · ipcn-api-dl — Chen, R. y. 1993. (editor), Chromosome Atlas of Chinese Fruit Trees and Their Close Wild Relatives. Chromosome Atlas Chin. Princ. Econ. Pl. 1.
CCDB · ipcn-api-dl — Costa Itayguara. 2006. Chromosome studies in Brazilian species of Campomanesia Ruiz & Pávon and Psidium L. (Myrtaceae Juss.). Caryologia 59(1): 7–13.
CCDB · ipcn-api-dl — Pedrosa, A. 1999. Citogenética de angiospermas coletadas em Pernambuco - V. Acta Bot. Brasil. 13(1): 49–60.
CCDB · book-ipcn67-71 — RAMAN, V.S., S.R. SREE RANGASAMY, & G. MANIMEKALAI. 1971. Triploidy and seedlessness in guava (Psidium guajava L.). Cytologia 36: 392-399.
CCDB · book-indian_vol1 — Janaki Ammal, E. K. (D. 1945) ; Atch- ison, E. 1947b; Roy, R.P. & Jha, R.P. 1962b; Hirano, R.T. & Nakasone, H.Y. 1969; Raikwar, S. K. S. & Roy, S. K. 1971b; Raman, V. S. eta!. 1971
CCDB · book-indian_vol1 — Roy, R .. P. & Jha, R. P. 1962b
CCDB · book-fedorov — J'anaki Ammal
CCDB · book-fedorov — D. 1945)
CCDB · book-fedorov — Atchison 1947b
CCDB · book-fedorov — Roy R. P., J'ha 1962
CCDB · book-atlas-flowering-plants — Atchison 1 9 4 7 b,
CCDB · kew — Ribeiro da Costa I, Dornelas MC, Forni-Martins ER. 2008. Nuclear genome size variation in fleshy-fruited Neotropical Myrtaceae. Plant Systematics and Evolution 276: 209-217.
CCDB · Cave1962 — Roy & Jha 1962
2n 444×CCDB · book-ipcn75-78 · CCDB · book-indian_vol1 · CCDB · book-fedorov +1
CCDB · book-ipcn75-78 — Srivastava 1977
CCDB · book-indian_vol1 — Naithani, S. P. & Srivastava, H. C. 1966 ; Srivastava, H.C. 1977a
CCDB · book-fedorov — Naithani, Srivastava 1966
GIFT · GIFT (floras)
2n 333×CCDB · book-indian_vol1 · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants
CCDB · book-indian_vol1 — Kumar, L. S. S. & Ranade, S. G. 1952
CCDB · book-fedorov — Kumar L. S., Ranade 1952 pl
CCDB · book-atlas-flowering-plants — Kumar & R. 1952
2n 301×GIFT · GIFT (floras)
GIFT · GIFT (floras)
2n 321×GIFT · GIFT (floras)
GIFT · GIFT (floras)
n 112×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Singhal, V. K., B. S. Gill & S. S. Bir. 1984. Cytology of cultivated woody species (Polypetalae). Proc. Indian Sci. Congr. Assoc. 71(3–VI): 143–144.
CCDB · ipcn-api-dl — Singhal, V. K., B. S. Gill & S. S. Bir. 1980. In Chromosome number reports LXVII. Taxon 29: 355–357.
n 211×GIFT · GIFT (floras)
GIFT · GIFT (floras)
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid2×GoaT · Kew Plant DNA C-values Database · GIFT · GIFT (floras)
GoaT · Kew Plant DNA C-values Database
GIFT · GIFT (floras)
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness98.3% BUSCO
07Deep time~22.3 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin22.3 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type45 847 records
Wild obs. + sensor37 541
Museum / vouchered7 707
Cultivated / captive140
Other459
Origin
Native84
Introduced2 407
Range
Area of Occupancy AOO71 964 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy78% within 1 km
≤100 m 9 438≤1 km 1 194≤10 km 2 571>10 km 442
13 645 georeferenced · 23 896 without coordinates
Open the mapobservation + sensor37 541
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy78% within 1 km
≤100 m 1 279≤1 km 155≤10 km 296>10 km 104
1 834 georeferenced · 5 873 without coordinates
Open the institutions mapphysical evidence7 707
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy50% within 1 km
≤1 km 1≤10 km 1
2 georeferenced · 138 without coordinates
Open the mapnot free-living140
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions190 of 437 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 700 |
| Durango, MX | 533 |
| Puerto Ayora, EC | 341 |
| ASUlocation not on record | 259 |
| Mexico City, MX | 241 |
| Bronx, US | 140 |
| Chapingo, MX | 133 |
| Mexico City, MX | 129 |
| Kunming, CN | 111 |
| Beijing, CN | 106 |
| Mérida, MX | 91 |
| Tapachula, MX | 91 |
| Paleontological Collectionlocation not on record | 72 |
| National Biodiversity Institute, Costa Ricalocation not on record | 72 |
| Tampa, US | 66 |
| University of Stellenboschlocation not on record | 64 |
| Brisbane, AU | 63 |
| Taipei, TW | 61 |
| Guangzhou, CN | 59 |
| Université de Strasbourglocation not on record | 58 |
| Kew, GB | 58 |
| Austin, US | 54 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 53 |
| Chicago, US | 51 |
| Guilin, CN | 50 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 50 |
| Antiguo Cuscatlán, SV | 50 |
| UnBlocation not on record | 49 |
| Quito, EC | 48 |
| Pretoria, ZA | 46 |
| Tuxtla Gutiérrez, MX | 42 |
| Miami, US | 40 |
| Universidade Federal do Maranhãolocation not on record | 35 |
| Smithfield, AU | 33 |
| JBRJlocation not on record | 32 |
| Durban, ZA | 32 |
| LSF/FSA/UAClocation not on record | 32 |
| San Francisco, US | 32 |
| MeiseBGlocation not on record | 31 |
| Salvador, BR | 28 |
| Leiden University Medical Centerlocation not on record | 28 |
| Universidad de Caldas (UCaldas)location not on record | 27 |
| Laboratorio de Ictiologialocation not on record | 27 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 26 |
| Nishihara, JP | 26 |
| BISHlocation not on record | 25 |
| UTFPR-CPlocation not on record | 25 |
| Honolulu, US | 25 |
| Chengdu, CN | 24 |
| Yangling, CN | 24 |
| Loja, EC | 24 |
| Baroda, IN | 24 |
| Museo Entomologico de Leonlocation not on record | 23 |
| Yaoundé, CM | 22 |
| Universidad de Antioquia (UdeA)location not on record | 22 |
| Corrientes, AR | 22 |
| Blumenau, BR | 22 |
| Canberra, AU | 22 |
| Campo Mourão, BR | 22 |
| UFBAlocation not on record | 21 |
| Masindi, UG | 21 |
| QCNElocation not on record | 21 |
| Maringá, BR | 20 |
| Mexico City, MX | 20 |
| Istituto Agrario Castelnuovolocation not on record | 20 |
| Nanjing, CN | 20 |
| Riverside, US | 20 |
| Cenargenlocation not on record | 20 |
| UEPAlocation not on record | 19 |
| Ciudad de México, MX | 19 |
| CJBGlocation not on record | 19 |
| León, NI | 19 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 18 |
| Foz do Iguaçu, BR | 18 |
| UEMAlocation not on record | 18 |
| San Isidro, AR | 18 |
| Adam Mickiewicz University in Poznańlocation not on record | 18 |
| Chaguaramas, TT | 18 |
| MAlocation not on record | 18 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 18 |
| Universidade Federal de Sergipe (UFS)location not on record | 18 |
| Chengdu, CN | 18 |
| UFRRJlocation not on record | 17 |
| UFMSlocation not on record | 17 |
| San Francisco de Campeche, MX | 17 |
| UNIVASFlocation not on record | 17 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 17 |
| Chapel Hill, US | 17 |
| Brasília, BR | 16 |
| Universidad Tecnológica del Chocó (UTCH)location not on record | 16 |
| Berlin, DE | 16 |
| Museu Paraense Emílio Goeldilocation not on record | 16 |
| Auckland, NZ | 16 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 15 |
| Universidad Industrial de Santander (UIS)location not on record | 15 |
| WAGlocation not on record | 15 |
| Mount Annan, AU | 15 |
| UEMlocation not on record | 15 |
| Universidad Nacional de Asunciónlocation not on record | 15 |
| Campo Grande, BR | 15 |
| Austin, US | 14 |
| Taipei, TW | 14 |
| Culiacán, MX | 14 |
| nlocation not on record | 14 |
| Xiamen, CN | 14 |
| Ilhéus, BR | 13 |
| Pontifícia Universidade Católica do Paranálocation not on record | 13 |
| Ivano-Frankivsk, UA | 13 |
| Herbier National du Gabonlocation not on record | 13 |
| Juriquilla, MX | 13 |
| Instituto do Meio Ambientelocation not on record | 13 |
| TAIElocation not on record | 12 |
| USP-IBlocation not on record | 12 |
| Autlán de Navarro, MX | 12 |
| Jena Microbial Resource Collectionlocation not on record | 12 |
| Seoul, KR | 12 |
| Universiti Sains Malaysialocation not on record | 12 |
| Tuxtla Gutiérrez, MX | 11 |
| Paris, FR | 11 |
| San Diego, US | 11 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 11 |
| Guatemala City, GT | 11 |
| Guasave, MX | 11 |
| Departamento de Sistematica e Ecologialocation not on record | 11 |
| Tlalnepantla, MX | 11 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 11 |
| Kathmandu, NP | 11 |
| Toluca, MX | 10 |
| Ciudad de México, MX | 10 |
| Santa Cruz de la Sierra, BO | 10 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 10 |
| Universidad Nacional de Colombia (UNAL)location not on record | 9 |
| Fundación Miguel Lillolocation not on record | 9 |
| Tsukuba, JP | 9 |
| Guiyang, CN | 9 |
| UFRPElocation not on record | 9 |
| Universidad Católica de Oriente (UCO)location not on record | 9 |
| Puebla, MX | 9 |
| Fortaleza, BR | 8 |
| ESALQlocation not on record | 8 |
| Philadelphia, US | 8 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 8 |
| South Kensington, GB | 8 |
| Chongqing Museumlocation not on record | 8 |
| Bloomington, US | 8 |
| Mérida, MX | 8 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 8 |
| IBANNlocation not on record | 8 |
| HUT Culture Collectionlocation not on record | 8 |
| UNESP-ISlocation not on record | 8 |
| MEXUlocation not on record | 8 |
| Cascavel, BR | 8 |
| St. Augustine, TT | 8 |
| UFOPlocation not on record | 8 |
| Santarém, BR | 8 |
| Universidad de Nariño (UdeNar)location not on record | 8 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 8 |
| Centro Cultural Santo Domingolocation not on record | 7 |
| Chengdu, CN | 7 |
| Universidad del Valle (UV)location not on record | 7 |
| Yunnan Universitylocation not on record | 7 |
| Montecillo, Texcoco, MX | 7 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 7 |
| Durham, US | 7 |
| CASlocation not on record | 7 |
| LSFlocation not on record | 7 |
| 云南省思茅市民族传统医药研究所location not on record | 7 |
| UFPRlocation not on record | 7 |
| LBVlocation not on record | 7 |
| Universidad de La Salle (La Salle)location not on record | 7 |
| HUENFlocation not on record | 7 |
| Station d'Ecologie de Lamtolocation not on record | 7 |
| Cambridge, US | 7 |
| UFPIlocation not on record | 7 |
| UNEMATlocation not on record | 6 |
| Altos de Pipe, VE | 6 |
| TAFORI-LSRClocation not on record | 6 |
| Uppsala, SE | 6 |
| Guiyang, CN | 6 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 6 |
| Iquitos, PE | 6 |
| Moscow State Universitylocation not on record | 6 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 6 |
| Aarhus, DK | 6 |
| Nishihara, JP | 6 |
| HNBlocation not on record | 6 |
| UFSJlocation not on record | 6 |
| Sucre, BO | 6 |
| Area de Conservacion Guanacastelocation not on record | 6 |
| FFPRIlocation not on record | 6 |
| Plocation not on record | 6 |
| Guizhou Forestry Schoollocation not on record | 6 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 6 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 5 |
| FJIDClocation not on record | 5 |
| Pondicherry, IN | 5 |
| CEPLAClocation not on record | 5 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 5 |
| UNISANTAlocation not on record | 5 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 5 |
| Uniwersytet Śląski w Katowicachlocation not on record | 5 |
| Feira de Santana, BR | 5 |
| FUNEDlocation not on record | 5 |
| UNESClocation not on record | 5 |
| Glocation not on record | 5 |
| Jataí / Setor Industrial, BR | 5 |
| Criciúma, BR | 5 |
| CNF-UFHBlocation not on record | 5 |
| Phoenix, US | 5 |
| UNESP-RClocation not on record | 5 |
| Burlington, US | 5 |
| Addis Ababa, ET | 5 |
| Southwest Forestry Collegelocation not on record | 5 |
| Bangkok, TH | 5 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 5 |
| UFPElocation not on record | 5 |
| Dresden, DE | 5 |
| Guiyang, CN | 5 |
| Nagano City, JP | 5 |
| Christchurch, NZ | 5 |
| arosemena tola, EC | 4 |
| Wuzhou, CN | 4 |
| Guangxi Agricultural Universitylocation not on record | 4 |
| Clocation not on record | 4 |
| Strecker Museum, Baylor Universitylocation not on record | 4 |
| Cusco, PE | 4 |
| Palmerston, AU | 4 |
| Herbario MAT de la Universidad Politécnica Estatal del Carchilocation not on record | 4 |
| Nagasaki University - Fisherieslocation not on record | 4 |
| Edinburgh, GB | 4 |
| Cape Town, ZA | 4 |
| UFVJMlocation not on record | 4 |
| San José, CR | 4 |
| UFSClocation not on record | 4 |
| EL PASO, US | 4 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 4 |
| Haramaya Universitylocation not on record | 4 |
| Armidale, AU | 4 |
| Centro de Ecologia Aplicada del Litoral (CECOAL-CONICET-UNNE)location not on record | 3 |
| South China Normal Universitylocation not on record | 3 |
| San Salvador de Jujuy, AR | 3 |
| UNESP-FCAlocation not on record | 3 |
| Mexico City, MX | 3 |
| Kensington, AU | 3 |
| Instituto de Investigação Científica Tropicallocation not on record | 3 |
| Calabar, NG | 3 |
| Hermosillo, MX | 3 |
| Rotorua, NZ | 3 |
| Cochabamba, BO | 3 |
| Frankfurt am Main | 3 |
| Brasília, BR | 3 |
| Davis, US | 3 |
| URCAlocation not on record | 3 |
| UFABClocation not on record | 3 |
| UFERSAlocation not on record | 3 |
| Cuiabá, BR | 3 |
| Teresina, BR | 3 |
| UTFPR-DVlocation not on record | 3 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 3 |
| BAYLUlocation not on record | 3 |
| BMlocation not on record | 3 |
| Universidad Nacional Agrarialocation not on record | 3 |
| Arequipa, PE | 3 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 3 |
| Fort Worth, US | 3 |
| Fundación Desarrollo y Ambiente FUNDAlocation not on record | 3 |
| HEMlocation not on record | 3 |
| Tuscaloosa, US | 3 |
| Cibinong Science Center, Herbarium Bogorienselocation not on record | 3 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 3 |
| Universidade de São Paulolocation not on record | 3 |
| QAPlocation not on record | 3 |
| Giardini Botanici Hanburylocation not on record | 3 |
| UTPLlocation not on record | 3 |
| Córdoba, AR | 3 |
| HUAlocation not on record | 3 |
| Museo universitario di Chietilocation not on record | 3 |
| Porto Velho, BR | 3 |
| McWane Science Centerlocation not on record | 3 |
| Uberlândia, BR | 3 |
| Instituto Nacional de Biodiversidad Herbario, Costa Ricalocation not on record | 3 |
| Lima, PE | 3 |
| Lake Charles, US | 2 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 2 |
| Universidad de Córdoba (UniCórdoba)location not on record | 2 |
| Institut de Recherche Agronomique de Guinée (IRAG)location not on record | 2 |
| BRLUlocation not on record | 2 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 2 |
| Guangzhou, CN | 2 |
| EMTCMlocation not on record | 2 |
| Hanshan Normal Universitylocation not on record | 2 |
| Wlocation not on record | 2 |
| Odawara, JP | 2 |
| Shanghai, CN | 2 |
| CPATSAlocation not on record | 2 |
| UNESP, Campus São José Rio Prêtolocation not on record | 2 |
| Federal University of Espírito Santolocation not on record | 2 |
| Zacatecas, MX | 2 |
| UERJlocation not on record | 2 |
| IPA/SPlocation not on record | 2 |
| Hebei Normal Universitylocation not on record | 2 |
| Taipei, TW | 2 |
| Central China Normal Universitylocation not on record | 2 |
| Guiyang, CN | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| OTSlocation not on record | 2 |
| UDESC-CAVlocation not on record | 2 |
| Riobamba, EC | 2 |
| Stockholm, SE | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| UTFPR-SLlocation not on record | 2 |
| Department of Botany Herbarium Ahmadu Bello University, Zarialocation not on record | 2 |
| Sri Ramaswamy Memorial Universitylocation not on record | 2 |
| University of Johannesburglocation not on record | 2 |
| UFSCarlocation not on record | 2 |
| Castelar, AR | 2 |
| Mexico City, MX | 2 |
| Minia, EG | 2 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 2 |
| Hangzhou, CN | 2 |
| Bogotá, D.C., CO | 2 |
| HACAMlocation not on record | 2 |
| UESBlocation not on record | 2 |
| Flagstaff, US | 2 |
| NO DISPONIBLElocation not on record | 2 |
| Universidade Federal de Santa Catarinalocation not on record | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| IECOSlocation not on record | 2 |
| Denver, US | 2 |
| Vancouver, CA | 2 |
| Adelaide, AU | 2 |
| Instituto de Investigaciones Botánicas y Zoológicas - Prof. Rafael M. Moscoso, Universidad Autónoma de Santo Domingolocation not on record | 2 |
| University of Hamburglocation not on record | 2 |
| Montréal, CA | 2 |
| UFESlocation not on record | 2 |
| La Paz, MX | 2 |
| Toronto, CA | 2 |
| Seropédica, BR | 2 |
| Guatemala, GT | 2 |
| La Paz, BO | 2 |
| Universidade Federal de Goiáslocation not on record | 1 |
| Department of Earth and Environmental Sciences, Yarmouk Universitylocation not on record | 1 |
| Universidad de El Salvadorlocation not on record | 1 |
| FLASlocation not on record | 1 |
| EAlocation not on record | 1 |
| INMAlocation not on record | 1 |
| UPNlocation not on record | 1 |
| Universidad Surcolombiana (USCO)location not on record | 1 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 1 |
| Salamanca, ES | 1 |
| Chadron, US | 1 |
| IANIGLAlocation not on record | 1 |
| Claremont, US | 1 |
| Jackson, US | 1 |
| Ann Arbor, US | 1 |
| Pittsburg, US | 1 |
| LDlocation not on record | 1 |
| Jiujiang Forestry Institutelocation not on record | 1 |
| Río Palenque Science Centerlocation not on record | 1 |
| University of Zhejianglocation not on record | 1 |
| LISClocation not on record | 1 |
| FPMZBlocation not on record | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| UFMGlocation not on record | 1 |
| Universidad de la Amazonia (UniAmazonia)location not on record | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| Universidad Autónoma de Nayaritlocation not on record | 1 |
| COLlocation not on record | 1 |
| Barcelona, ES | 1 |
| GZUlocation not on record | 1 |
| Madison, US | 1 |
| AMDlocation not on record | 1 |
| Cuenca, EC | 1 |
| Northridge, US | 1 |
| UADYlocation not on record | 1 |
| Université de Bordeauxlocation not on record | 1 |
| NHMJlocation not on record | 1 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| Smithsonian Institution, National Museum of Natural Historylocation not on record | 1 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 1 |
| Ojo, NG | 1 |
| Instituto de Ecología, Universidad Nacional Autónoma de Méxicolocation not on record | 1 |
| UNESP-FCAVlocation not on record | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| California Academy of Scienceslocation not on record | 1 |
| Jinghong, CN | 1 |
| Chiba, JP | 1 |
| FJFClocation not on record | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| 河南豫北黄河故道湿地鸟类国家级自然保护区location not on record | 1 |
| University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record | 1 |
| Kagoshima, JP | 1 |
| National Herbarium of São Tomé and Principelocation not on record | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| UNESP-IBILCElocation not on record | 1 |
| Dekalb, US | 1 |
| Mount Pleasant, US | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Sangmiung Universitylocation not on record | 1 |
| *unvoucheredlocation not on record | 1 |
| UNITINSlocation not on record | 1 |
| Brussels, BE | 1 |
| Universidad Tecnológica del Chocólocation not on record | 1 |
| Valdosta State Universitylocation not on record | 1 |
| Lubbock, US | 1 |
| San Luis Obispo, US | 1 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 1 |
| Londrina, BR | 1 |
| Herbario de la Universidad Técnica del Nortelocation not on record | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| Instituto Nacional de Investigaciones sobre Recursos Bióticoslocation not on record | 1 |
| Sendai, JP | 1 |
| Facultad de Ingeniería en Tecnología de la Madera, Universidad Michoacana de San Nicolás de Hidalgolocation not on record | 1 |
| UNIVILLElocation not on record | 1 |
| Nnamdi Azikiwe University Herbarium (NAUH)location not on record | 1 |
| AUAlocation not on record | 1 |
| CMULlocation not on record | 1 |
| PUC-RIOlocation not on record | 1 |
| Hudson, US | 1 |
| PUC-RSlocation not on record | 1 |
| Mississippi State, US | 1 |
| Universidade Federal do Espírito Santolocation not on record | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| Arizona State University Biocollectionslocation not on record | 1 |
| Cruz das Almas, BR | 1 |
| HAWlocation not on record | 1 |
| Hobart, AU | 1 |
| San Luis Potosí, MX | 1 |
| SMMUlocation not on record | 1 |
| FUVATESlocation not on record | 1 |
| Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record | 1 |
| Morelia, MX | 1 |
| Universidad del Tolima (UT)location not on record | 1 |
| Gump Stationlocation not on record | 1 |
| Arusha, TZ | 1 |
437 institutions · 6 792 of 7 707 vouchered records shown · 572 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA61 detections
Where the DNA of Psidium guajava was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found61
Studies independent surveys5
Countries8
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 61 detections have coordinates
Open the map8 countries0
Willow riparian forest, with water supplemen…Willow riparian forest, with water supplemen…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median21.9 °C 13.3–25.0
Seasonal swing summer↔winter8.10 °C
Max temp (day)26.0 °C 19.2–29.6
Min temp (night)17.8 °C 8.60–22.4
Precipitation167 mm/mo 40.4–468
Air humidity61.3 % 52.0–69.0
Moisture balance39.0 mm/mo
Vapour deficit1,004 Pa 694–1,304
Wind speed3.30 m/s
Cloud cover36.6 % 18.9–53.6
CHELSA 1981–2010, ~9 km grid, at location & month of 49 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.