Pseuduvaria aurantiaca — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Magnoliales/Annonaceae/Pseuduvaria

At a glance

Occurrence records12

Data sources7

Biological traits4

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Pseuduvaria aurantiaca's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility12 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources4 traits

Occurrence & distributionGBIF12 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Pseuduvaria aurantiaca is a species of plant in the family Annonaceae. It is endemic to New Guinea. Friedrich Anton Wilhelm Miquel, the Dutch botanist who first formally described the species using the basionym Orophea aurantiaca, named it after its orange colored (, in Latin) fruit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction1

Life spanperennial

Habitat & environment3

Climatewet tropical

Growth formtree

Woodinesswoody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pseuduvaria aurantiaca has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLEU522348.1 ↗807 bpIndonesia

ACGT

TCCCTCCCTACAACTCATGAATTAAGAATTCTCACAACGACAAGATCTACTCGACATGGATTAGGCGTGAATGAAACCTTTCACAGGAAT …

Pseuduvaria aurantiaca ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; rbcL-atpB intergenic spacer, complete sequence; and AtpB (atpB) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL2

plant barcode

08Occurrence & distribution

Record type12 records

Museum / vouchered12

Range

Area of Occupancy AOO28 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 12 records without

Open the institutions mapphysical evidence12

09Environmental DNA2 detections

Where the DNA of Pseuduvaria aurantiaca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.9 °C 25.9–25.9

Seasonal swing summer↔winter0.5 °C

Max temp (day)29.8 °C

Min temp (night)22.3 °C

Precipitation343 mm/mo

Air humidity69.6 %

Moisture balance205 mm/mo

Vapour deficit1,012 Pa

Wind speed0.6 m/s

Cloud cover57.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.