Pseudoziziphus parryi

(Torr.) Hauenschild · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rhamnaceae/Pseudoziziphus

At a glance

Occurrence records816

Data sources9

Biological traits13

DNA specimens3

eDNA detections2

Sources9 archives

Databases and archives Pseudoziziphus parryi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility816 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF816 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Ziziphus parryi is a species of flowering plant in the buckthorn family known by the common name Parry's jujube.Calflora: Ziziphus parryi

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Plant height3.41 m

Life cycle & reproduction3

Deciduousnessdrought deciduous

Life formshrub or tree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density672 mg/cm³

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pseudoziziphus parryi has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJN900303.1 ↗669 bp

ACGT

AAGGATCATTGTTGAAACCCTGCACAGCAGAACGACCCGTGAACTCGTAAAACACAACCGGGGGGCGAGGGCCCAACCCGAACCCCCTTG …

Ziziphus parryi isolate ZP01 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcLa★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type816 records

Wild obs. + sensor807

Museum / vouchered9

Range

Area of Occupancy AOO752 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 416≤1 km 38≤10 km 8>10 km 6

468 georeferenced · 339 without coordinates

Open the mapobservation + sensor807

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 3≤10 km 3

6 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Severin-McDaniel Insect Collectionlocation not on record	4
San Diego, US	3
San Diego Natural History Museum, Herbariumlocation not on record	1
Logan, US	1

4 institutions · 9 of 9 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Pseudoziziphus parryi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

Acacia greggii, Eriodictyon trichocalyx lana…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.7 °C 13.7–13.7

Seasonal swing summer↔winter16.4 °C

Max temp (day)21.1 °C

Min temp (night)7.40 °C

Precipitation23.6 mm/mo

Air humidity47.6 %

Moisture balance-131 mm/mo

Vapour deficit827 Pa

Wind speed4.90 m/s

Cloud cover33.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)