Pseudoxytenanthera ritcheyi

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Pseudoxytenanthera

At a glance

Occurrence records0

Data sources6

Biological traits6

DNA specimens4

eDNA detections2

Sources6 archives

Databases and archives Pseudoxytenanthera ritcheyi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Pseudoxytenanthera ritcheyi is a species of plant belonging to the genus Pseudoxytenanthera of the grass family, Poaceae. It is an Asian bamboo commonly called the "erankol". The species grows in wild in the plains and foothills of South Indian regions.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formbamboo

Diet & foraging1

Parasiteindependent

Habitat & environment4

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pseudoxytenanthera ritcheyi has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences10

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJX139109.1 ↗715 bp

ACGT

AATTTTTGTTAAGTCGTTACAAGGAGAACATAAGGAACGTTTGGAAAGATCAACGTTAGAACTATAATGGACAATGACCCGAGAAAAGAA …

Pseudoxytenanthera ritcheyi 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK4rbcL5ITS1trnH-psbA

plant barcodefungal barcodemarker

09Environmental DNA2 detections

Where the DNA of Pseudoxytenanthera ritcheyi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.