Pseudovanilla foliata

(F.Muell.) Garay · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Pseudovanilla

At a glance

Occurrence records271

Data sources7

Biological traits27

DNA specimens3

eDNA detections2

Sources7 archives

Databases and archives Pseudovanilla foliata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility271 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources27 traits

Occurrence & distributionGBIF271 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Pseudovanilla foliata, commonly known as the great climbing orchid, is a plant in the orchid family native to Queensland, New South Wales, and New Guinea. It is a terrestrial orchid with a vining vegetative habit, climbing by means of adventitious roots produced at nodes. Its leaves are reduced, and the species is considered to be at least partially mycoheterotrophic.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology8

Fruit length200 mm

Fruit width32.5 mm

Leaf length45 mm

Leaf length max60 mm

Leaf length min30 mm

Leaf width37.5 mm

Leaf width max50 mm

Leaf width min25 mm

Life cycle & reproduction8

Dehiscencedehiscent

Flowering endJan

Flowering startOct

Flowering timeynnnnnnnnyyy

Life formholomycotrophic rhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapeovate

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pseudovanilla foliata has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLAY381130.1 ↗1 322 bp

ACGT

CGTTGGATTTAAGGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGATTACCAAACCAAAGATACTGATATCTTGGCAGCATT …

Pseudovanilla foliata ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1

plant barcode

08Occurrence & distribution

Record type271 records

Wild obs. + sensor158

Museum / vouchered113

Origin

Native15

Introduced1

Range

Area of Occupancy AOO692 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 53≤1 km 6≤10 km 6>10 km 81

146 georeferenced · 12 without coordinates

Open the mapobservation + sensor158

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy3% within 1 km

≤100 m 2≤1 km 1≤10 km 88>10 km 3

94 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence113

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	26
Smithfield, AU	25
Museo Entomologico de Leonlocation not on record	21
Mount Annan, AU	16
Canberra, AU	15
Cibinong, ID	2
Llocation not on record	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
University of the Sunshine Coastlocation not on record	1
Armidale, AU	1
TNMlocation not on record	1
Saint Louis, US	1

12 institutions · 111 of 113 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Pseudovanilla foliata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.1 °C 23.1–23.1

Seasonal swing summer↔winter9.40 °C

Max temp (day)28.2 °C

Min temp (night)18.6 °C

Precipitation112 mm/mo

Air humidity61.8 %

Moisture balance-54.7 mm/mo

Vapour deficit1,072 Pa

Wind speed3.20 m/s

Cloud cover21.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)