Pseudoscaphirhynchus kaufmanni

(Kessler, 1877) · species

image placeholder — illustration coming later

Animalia/Chordata/Acipenseriformes/Acipenseridae/Pseudoscaphirhynchus

At a glance

Occurrence records38

Data sources11

Biological traits0

DNA specimens15

eDNA detections17

Sources11 archives

Databases and archives Pseudoscaphirhynchus kaufmanni's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility32 records↗

OBISOcean Biodiversity Information System6 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~1.70 Gbp↗

Paleobiology DatabasePBDB consortiumfossil record↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS38 records

Environmental DNA1 datasets · 1 countries17 detections

DNA & barcodingBOLD15 specimens

Genome at a glanceGoaT1.7 Gbp

01Narrative

The Amu Darya sturgeon or false shovelnose sturgeon (Pseudoscaphirhynchus kaufmanni) is a critically endangered species of fish in the family Acipenseridae. It is found in Turkmenistan, Uzbekistan, Tajikistan and perhaps Afghanistan. It inhabits quite shallow flowing waters that are turbid and muddy.Birstein, V.J.; J.R. Waldman; and W.E. Bemis, editors (1997). Sturgeon biodiversity and conservation, pp. 377–378, 381–382. Kluwer Academic Publishing.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pseudoscaphirhynchus kaufmanni has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections17

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 44 variable positions, in barcode order

16Cmostly conserved

79Amostly conserved

85Tmostly conserved

103Tmostly conserved

124Cmostly conserved

142Tmostly conserved

148Tmostly conserved

172Gmostly conserved

175Tmostly conserved

178Tmostly conserved

211Cmostly conserved

244Tmostly conserved

259Amostly conserved

262Tmostly conserved

289Amostly conserved

295Cmostly conserved

313Amostly conserved

349Avariable

412Amostly conserved

415Tmostly conserved

424Cmostly conserved

427Gmostly conserved

439Cmostly conserved

451Gmostly conserved

484Amostly conserved

487Cmostly conserved

497Tmostly conserved

541Cmostly conserved

574Gmostly conserved

578Tmostly conserved

589Amostly conserved

595Amostly conserved

598Cmostly conserved

601Cmostly conserved

604Cmostly conserved

605Tmostly conserved

606Tmostly conserved

608Tmostly conserved

609Tmostly conserved

611Gmostly conserved

613Cmostly conserved

617Gmostly conserved

643Tmostly conserved

646Gmostly conserved

CCTGTATTTAGTATTCGGTGCCTGAGCAGGCATAGTCGGCACAGCCCTCAGCCTTCTGATCCGTGCCGAACTGAGCCAACCCGGTGCCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes4

BIN1

Most divergent pair0.46%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acipenser brevirostrumsame family4.1%Acipenser transmontanussame family4.4%Acipenser schrenckiisame family4.8%Acipenser gueldenstaedtiisame family4.8%Acipenser naccariisame family4.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_050885 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT

The complete instruction manual Pseudoscaphirhynchus kaufmanni carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 701 720 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Pseudoscaphirhynchus kaufmanni1.7 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type38 records

Wild obs. + sensor23

Museum / vouchered15

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 23

23 georeferenced

Open the mapobservation + sensor23

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 9

9 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	2
Cambridge, US	2
	1
Champaign, US	1

4 institutions · 6 of 15 vouchered records shown · 3 without an institution code

09Environmental DNA17 detections

Where the DNA of Pseudoscaphirhynchus kaufmanni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.5 °C -2.10–29.2

Seasonal swing summer↔winter31.6 °C

Max temp (day)27.4 °C 2.80–35.2

Min temp (night)14.5 °C -5.80–22.6

Precipitation12.2 mm/mo 2.00–12.7

Air humidity45.1 % 39.9–61.6

Moisture balance-158 mm/mo -229–-14.9

Vapour deficit1,402 Pa 205–2,423

Wind speed4.10 m/s 3.60–4.70

Cloud cover28.6 % 15.5–55.7

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)