Pseudosamanea cubana — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Pseudosamanea

At a glance

Occurrence records18

Data sources9

Biological traits4

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Pseudosamanea cubana's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility18 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources4 traits

Occurrence & distributionGBIF18 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 26

01Narrative

Pseudosamanea cubana is a tree species in the legume family (Fabaceae). It is found only in Cuba. Presently, this is the only member of the genus Pseudosamanea. Pseudosamanea guachapele is a junior synonym of Albizia guachapele.ILDIS (2005)

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction1

Life formtree

Habitat & environment3

Climateseasonally dry tropical

Growth formtree

Woodinesswoody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pseudosamanea cubana has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSMW699941.1 ↗582 bp

ACGT

AAAAGAGTGACCCACGAACCGGTAGGAACGTACCTCTAGCAGAGGAAGGCGACGACCACACCTGAGGCCTCCCCCGACAACCGAACCCCG …

Pseudosamanea cubana voucher GHBG 001 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL1ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pseudosamanea cubana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 261×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Jarolĭmovă. 1994. Chromosome counts of some Cuban angiosperms. Folia Geobot. Phytotax. 29: 101–106.

n 131×CCDB · Cannon, 2015

CCDB · Cannon, 2015 — Jarolimova, V., 1994

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type18 records

Museum / vouchered18

Range

Area of Occupancy AOO68 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 18 records without

Open the institutions mapphysical evidence18