Pseudorhipsalis ramulosa

(Salm-Dyck) Barthlott · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Pseudorhipsalis

At a glance

Occurrence records112

Data sources9

Biological traits10

DNA specimens4

eDNA detections1

Sources9 archives

Databases and archives Pseudorhipsalis ramulosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility112 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources10 traits

Occurrence & distributionGBIF112 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Pseudorhipsalis ramulosa là một loài thực vật có hoa trong họ Cactaceae. Loài này được (Salm-Dyck) Barthlott miêu tả khoa học đầu tiên năm 1991.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climberself-supporting

Elevation max1 840 m

Elevation min1 000 m

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Habitat GIFTFloresta de Terra Firme

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pseudorhipsalis ramulosa has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes5

GenBank sequences6

eDNA detections1

Countries4

The DNA barcodea real sequence read deposited for this species

ITSOL536625.1 ↗346 bpUSA · 2018

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Kimnachia ramulosa voucher MO:Carlsen3118 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL1★ITS1★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Pseudorhipsalis ramulosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 223×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Gadella, T. W. J., E. KLIPHUIS & J. Naber. 1979. Chromosome numbers in the tribe Rhipsalinae (Cactaceae). Bot. Not. 132:294.

CCDB · ipcn-api-dl — Thompson, M. 1993. <In> M. Kimnach, The genus Disocactus. Haseltonia 1: 95–139.

CCDB · ipcn-api-dl — PEEV, D. 1976. In IOPB chromosome number reports LIV. Taxon 25: 631–649.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type112 records

Wild obs. + sensor1

Museum / vouchered110

Cultivated / captive1

Range

Area of Occupancy AOO316 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 2≤1 km 1≤10 km 5

8 georeferenced · 102 without coordinates

Open the institutions mapphysical evidence110

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	44
Bronx, US	12
León, NI	9
National Biodiversity Institute, Costa Ricalocation not on record	8
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	4
Xiamen, CN	2
HUAlocation not on record	2
Universidad del Quindío (UniQuindío)location not on record	2
Universidad de Antioquia (UdeA)location not on record	2
MEXUlocation not on record	2
Guatemala, GT	2
Chicago, US	1
Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record	1
Universiti Sains Malaysialocation not on record	1
Tampa, US	1
Berlin, DE	1
Mexico City, MX	1
Santa Cruz de la Sierra, BO	1
The Huntington Library, Art Museum, and Botanical Gardenslocation not on record	1
Aarhus, DK	1
Santiago de Cali, CO	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Mérida, MX	1
South Kensington, GB	1
University of Stellenboschlocation not on record	1
San José, CR	1
Fort Worth, US	1
Tapachula, MX	1
Universidad de La Salle (La Salle)location not on record	1

29 institutions · 107 of 110 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Pseudorhipsalis ramulosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 13.6–13.6

Seasonal swing summer↔winter26.3 °C

Max temp (day)19.5 °C

Min temp (night)8.70 °C

Precipitation114 mm/mo

Air humidity54.5 %

Moisture balance0.9 mm/mo

Vapour deficit709 Pa

Wind speed4.00 m/s

Cloud cover44.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)