Pseudorhipsalis amazonica

(K.Schum.) Ralf Bauer · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Pseudorhipsalis

At a glance

Occurrence records241

Data sources9

Biological traits11

DNA specimens3

eDNA detections2

Sources9 archives

Databases and archives Pseudorhipsalis amazonica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility241 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF241 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Pseudorhipsalis amazonica là một loài thực vật có hoa trong họ Cactaceae. Loài này được (K.Schum.) Ralf Bauer miêu tả khoa học đầu tiên năm 2002 publ. 2003.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formsucculent epiphyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 200 m

Elevation min0 m

Epiphyteobligatory

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Epiphyte

Woodinesswoody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pseudorhipsalis amazonica has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences8

eDNA detections2

Countries5

The DNA barcodea real sequence read deposited for this species

rbcLOL537070.1 ↗553 bpUSA · 2019

ACGT

AAGTGTTGGATTTAAAGCAGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAATATCAACCCCAGGATACCGATATCTTGGCAGC …

Pseudorhipsalis amazonica voucher MO:Carlsen3566 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK7★rbcL1trnH-psbA

plant barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Pseudorhipsalis amazonica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Thompson, M. 1993. <In> M. Kimnach, The genus Disocactus. Haseltonia 1: 95–139.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type241 records

Wild obs. + sensor31

Museum / vouchered208

Cultivated / captive2

Origin

Native1

Range

Area of Occupancy AOO580 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 13≤1 km 3≤10 km 2>10 km 1

19 georeferenced · 12 without coordinates

Open the mapobservation + sensor31

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 2≤1 km 1≤10 km 1

4 georeferenced · 204 without coordinates

Open the institutions mapphysical evidence208

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	85
Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record	25
National Biodiversity Institute, Costa Ricalocation not on record	13
Universiti Sains Malaysialocation not on record	12
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	10
QCNElocation not on record	9
Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record	8
FLASlocation not on record	8
HUT Culture Collectionlocation not on record	5
Aarhus, DK	4
arosemena tola, EC	3
Chicago, US	3
Iquitos, PE	2
Bronx, US	2
Fundación Jardín Botánico Joaquín Antonio Uribe de Medellínlocation not on record	2
Loja, EC	1
Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record	1
JBRJlocation not on record	1
COLlocation not on record	1
Universidad Tecnológica del Chocó (UTCH)location not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Universidad de Caldas (UCaldas)location not on record	1
Cusco, PE	1
Berlin, DE	1
Lima, PE	1
Smithsonian Tropical Research Institutelocation not on record	1
Cambridge, US	1
Universidad de la Amazonia (UniAmazonia)location not on record	1
Universidad Industrial de Santander (UIS)location not on record	1
Porto Velho, BR	1

30 institutions · 206 of 208 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Pseudorhipsalis amazonica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.8 °C 25.8–25.8

Seasonal swing summer↔winter14.8 °C

Max temp (day)30.4 °C 29.9–30.8

Min temp (night)21.8 °C 21.4–22.1

Precipitation176 mm/mo 130–222

Air humidity61.4 % 58.1–64.6

Moisture balance6.80 mm/mo -51.5–65.1

Vapour deficit1,286 Pa 1,184–1,388

Wind speed2.60 m/s 2.50–2.60

Cloud cover29.7 % 29.1–30.3

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)