Pseudonympha trimenii

Butler, 1868 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Pseudonympha

At a glance

Occurrence records23

Data sources8

Biological traits0

DNA specimens8

eDNA detections8

Sources8 archives

Databases and archives Pseudonympha trimenii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility23 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF23 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD8 specimens

01Narrative

Pseudonympha trimenii, or Trimen's brown, is a butterfly of the family Nymphalidae. It is found in South Africa. The wingspan is 40–52 mm for males and 44–56 mm for females. Adults are on wing from early September to late November. There is one generation per year. The larvae feed on Poaceae grasses, including Danthonia stricta and other coarse, wiry grasses.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pseudonympha trimenii has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections8

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P595 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Diversity (π)4.2%

Haplotypes2

BIN1

Most divergent pair1.0%

Where individuals differ — all 75 variable positions, in barcode order

7Cmostly conserved

19Amostly conserved

20Cmostly conserved

23Amostly conserved

26Amostly conserved

28Tmostly conserved

38Amostly conserved

62Cmostly conserved

65Tmostly conserved

77Amostly conserved

98Amostly conserved

101Tmostly conserved

104Amostly conserved

107Tmostly conserved

135Cmostly conserved

137Tmostly conserved

138Amostly conserved

140Tmostly conserved

150Cvariable

161Tmostly conserved

176Tmostly conserved

182Amostly conserved

201Cmostly conserved

203Tmostly conserved

209Cmostly conserved

212Tmostly conserved

215Tmostly conserved

219Amostly conserved

233Amostly conserved

245Tmostly conserved

257Tmostly conserved

266Tmostly conserved

275Amostly conserved

284Tmostly conserved

293Amostly conserved

297Amostly conserved

299Tmostly conserved

306Gmostly conserved

308Amostly conserved

312Tmostly conserved

317Tmostly conserved

320Tmostly conserved

338Amostly conserved

350Tmostly conserved

353Amostly conserved

359Tmostly conserved

374Tmostly conserved

380Tmostly conserved

392Amostly conserved

395Tmostly conserved

404Amostly conserved

407Amostly conserved

417Amostly conserved

422Avariable

424Amostly conserved

435Cmostly conserved

437Tmostly conserved

438Tmostly conserved

444Gmostly conserved

452Amostly conserved

455Tmostly conserved

458Amostly conserved

464Tmostly conserved

467Tmostly conserved

480Cmostly conserved

482Tmostly conserved

488Avariable

503Amostly conserved

516Cmostly conserved

519Cmostly conserved

521Tmostly conserved

527Tmostly conserved

530Amostly conserved

539Tmostly conserved

542Amostly conserved

TTCGAACAGAATTAGGTAACCCAGGATTTTTAATTGGAGATGATCAAATTTATAATACTATCGTTACAGCACATGCATTTATTATAATTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pseudonympha swanepoelisame genus3.4%Pseudonympha variisame genus3.4%Maniola nuragsame family6.9%Oeneis melissasame family7.1%Hyponephele davendrasame family7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type23 records

Wild obs. + sensor11

Museum / vouchered12

Range

Area of Occupancy AOO80 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 9≤1 km 1

10 georeferenced · 1 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤1 km 1≤10 km 3>10 km 2

6 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	5
University of Johannesburglocation not on record	1
Durban Natural Science Museumlocation not on record	1
MZLUlocation not on record	1

4 institutions · 8 of 12 vouchered records shown · 4 without an institution code

09Environmental DNA8 detections

Where the DNA of Pseudonympha trimenii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 13.6–15.8

Seasonal swing summer↔winter12.6 °C

Max temp (day)20.6 °C 20.5–22.4

Min temp (night)7.30 °C 6.90–8.70

Precipitation31.1 mm/mo 22.9–38.9

Air humidity51.0 % 48.5–52.8

Moisture balance-83.7 mm/mo -109–-73.3

Vapour deficit848 Pa 735–919

Wind speed3.80 m/s 3.30–4.70

Cloud cover12.7 % 11.1–17.1

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)