Pseudolmedia hirtula — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Rosales/Moraceae/Pseudolmedia

At a glance

Occurrence records25

Data sources6

Biological traits13

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Pseudolmedia hirtula's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility25 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources13 traits

Occurrence & distributionGBIF25 records

DNA & barcodingNCBIsequences

01Narrative

Pseudolmedia hirtula is a species of plant in the family Moraceae also known as the fig tree family. Endemic to Brazil's Atlantic rain forest, it is threatened by habitat loss, caused by humans using slash and burn methods to make room for more cropland and grazing pastures. It is listed as an endangered species on the IUCN red list

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology1

Plant height max23 m

Life cycle & reproduction2

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formtree

Habitat GIFTFloresta Ombrófila (= Floresta Pluvial)

Woodinesswoody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pseudolmedia hirtula has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSMN402541.1 ↗631 bp

ACGT

GATCATTGTCGAGACCCACCCCGCCAGAACGACCCGCGAACGCGTTACAACACTCGGGGGGGCGAGGGGTGCTAACACCTCCCCGGACCC …

Pseudolmedia hirtula voucher H.C. de Lima 2298 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type25 records

Museum / vouchered25

Origin

Native4

Range

Area of Occupancy AOO64 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence25

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UFRRJlocation not on record	4
Bronx, US	4
San Jose State University, Museum of Birds and Mammalslocation not on record	4
Universidade do Estado de Mato Grossolocation not on record	2
Blumenau, BR	2
Seropédica, BR	2
Chicago, US	2
JBRJlocation not on record	2
Ivano-Frankivsk, UA	1
IPA/SPlocation not on record	1
USP-IBlocation not on record	1

11 institutions · 25 of 25 vouchered records shown