Pseudoliparis belyaevi

Andriashev & Pitruk, 1993 · species

image placeholder — illustration coming later

Animalia/Chordata/Scorpaeniformes/Liparidae/Pseudoliparis

At a glance

Occurrence records4

Data sources7

Biological traits6

DNA specimens13

eDNA detections13

Sources7 archives

Databases and archives Pseudoliparis belyaevi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 records↗

OBISOcean Biodiversity Information System2 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS4 records

Environmental DNA1 datasets · 0 countries13 detections

DNA & barcodingBOLD13 specimens

01Narrative

Pseudoliparis belyaevi is een straalvinnige vissensoort uit de familie van slakdolven (Liparidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1993 door Andriashev & Pitruk.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length10.8 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebathydemersal

Other traits3

Depth max8 336 m

Depth min6 380 m

Vulnerability10

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pseudoliparis belyaevi has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P675 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

42Gmostly conserved

48Gmostly conserved

108Cmostly conserved

177Amostly conserved

214Cmostly conserved

GACATTGGCACCCTTTATCTAGTATTTGGTGCTTGAGCTGGGATGGTGGGAACAGGCCTGAGTTTATTAATTCGAGCCGAACTTAGCCAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.11%

Haplotypes5

BIN1

Most divergent pair0.44%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Careproctus longipectoralissame family6.1%Careproctus georgianussame family6.4%Paraliparis antarcticussame family6.7%Paraliparis charcotisame family6.8%Rhodichthys reginasame family7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 records

Museum / vouchered4

Range

Area of Occupancy AOO8 km²

Depth

0–200 m sunlit0

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal2

median 7 576 m · max 7 576 m · 2 records with depth

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the institutions mapphysical evidence4

10Collections & institutions

Institution	Specimens
FishBaselocation not on record	2

1 institutions · 2 of 4 vouchered records shown

09Environmental DNA13 detections

Where the DNA of Pseudoliparis belyaevi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)