Pseudojuloides elongatus

Ayling & Russell, 1977 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Labridae/Pseudojuloides

At a glance

Occurrence records99

Data sources8

Biological traits7

DNA specimens4

eDNA detections0

Sources8 archives

Databases and archives Pseudojuloides elongatus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility49 records↗

OBISOcean Biodiversity Information System50 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS99 records

DNA & barcodingBOLD4 specimens

01Narrative

The long green wrasse, Pseudojuloides elongatus, is a species of wrasse native to coastal waters from Australia to New Zealand and Norfolk Island (records from the Izu Islands, Japan are considered an undescribed species). This species occurs to depths around 25 m in weedy areas on reefs. It can reach 12.6 cm in standard length. This species is also found the aquarium trade.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length14 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max50 m

Depth min2 m

Vulnerability10

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pseudojuloides elongatus has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.41%

Haplotypes2

BIN1

Most divergent pair0.61%

Where individuals differ — all 4 variable positions, in barcode order

73Avariable

97Avariable

118Avariable

496Cvariable

CCTTTATCTGGTATTCGGTGCCTGAGCTGGGATAGTAGGGACAGCCTTAAGCCTACTAATTCGAGCCGAGCTAAGCCAGCCCGGCGCTCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pseudojuloides argyreogastersame genus8.3%Pseudojuloides edwardisame genus14.1%Pseudojuloides severnsisame genus14.4%Trachyscorpia eschmeyerisame order14.9%Trachyscorpia cristulatasame order15.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type99 records

Wild obs. + sensor31

Museum / vouchered68

Range

Area of Occupancy AOO148 km²

Depth

0–200 m sunlit11

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 9 m · max 25 m · 11 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 3≤1 km 3≤10 km 6>10 km 3

15 georeferenced · 16 without coordinates

Open the mapobservation + sensor31

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 2≤1 km 20≤10 km 20>10 km 8

50 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence68

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	14
Auckland, NZ	2
Honolulu, US	2
FishBaselocation not on record	1
Museums Victorialocation not on record	1
Natick, US	1
Toronto, CA	1
University of California San Diegolocation not on record	1
Western Australian Museumlocation not on record	1

9 institutions · 24 of 68 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)