Pseudois nayaur

(Hodgson, 1833) · species

image placeholder — illustration coming later

Animalia/Chordata/Mammalia/Artiodactyla/Bovidae/Pseudois

At a glance

Occurrence records735

Data sources12

Biological traits18

DNA specimens77

eDNA detections67

Sources12 archives

Databases and archives Pseudois nayaur's data was compiled from.

WikipediaWikimedia Foundation18 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility735 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI67 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics77 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements4 literature sources18 traits

Occurrence & distributionGBIF735 records

Environmental DNA1 datasets · 3 countries67 detections

DNA & barcodingBOLD77 specimens

Genome at a glanceGoaT · NCBI≈2.6 Gbp

01Narrative

The bharal (Pseudois nayaur), also called the blue sheep, is a caprine native to the high Himalayas. It is the only member of the genus Pseudois. It occurs in India, Bhutan, China (in Gansu, Ningxia, Sichuan, Tibet, and Inner Mongolia), Myanmar, Nepal, and Pakistan. The Helan Mountains of Ningxia have the highest concentration of bharal in the world, with 15 bharals per km2 and 30,000 in total. Its native names include yanyang (岩羊) in Mandarin, bharal, barhal, bharar, and bharut in Hindi, na or sna in Tibetan and Ladakh, nabo in Spitian, naur in Nepali and na or gnao in Bhutan.Lydekker, R. (1900). The great and small game of India, Burma and Tibet, p 93, The bharal was also the focus of George Schaller and Peter Matthiessen's expedition to Nepal in 1973. Their personal experiences are well documented by Matthiessen in his book, The Snow Leopard. The bharal is a major prey of the snow leopard.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPanTHERIAAnAgeAmnioteDBEltonTraits

Size & morphology3

Body mass52 335 g

⚠ sources differ — PanTHERIA: 52 335 g · AnAge: 55 000 g · AmnioteDB: 52 335 g · EltonTraits: 45 000 g

Head body length1 300 mm

SVL147 cm

Life cycle & reproduction5

Age at sexual maturity421 days

⚠ sources differ — PanTHERIA: 421 days · AnAge: 730 days · AmnioteDB: 566 days

Gestation160 days

Litter size1.22

⚠ sources differ — PanTHERIA: 1.22 · AnAge: 1.5 · AmnioteDB: 1.5

Max. longevity288 months

⚠ sources differ — PanTHERIA: 288 months · AnAge: 251 months · AmnioteDB: 288 months

Weaning age182 days

Diet & foraging3

Breadth2

Plant other100 %

Trophic levelherbivore

Habitat & environment2

Habitat breadth1

Terrestriality1.00

Physiology & chemistry2

Precipitation mean55.16 mm

Temperature mean-27.86 decidegC

Other traits3

Activity cycle3.00

Foraging stratumG

Population density2.49 /km²

05DNA & barcoding77 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pseudois nayaur has left across the world's sequence archives.

At a glance

DNA specimens77

BINs4

Marker genes11

eDNA detections67

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 30 variable positions, in barcode order

16Avariable

28Amostly conserved

37Amostly conserved

56Tmostly conserved

59Cvariable

82Gmostly conserved

85Tvariable

106Tvariable

124Cvariable

130Cvariable

181Amostly conserved

235Cmostly conserved

238Tmostly conserved

340Cvariable

343Cmostly conserved

388Gmostly conserved

415Cmostly conserved

418Tvariable

433Gmostly conserved

436Cvariable

487Amostly conserved

502Gvariable

508Gmostly conserved

514Tmostly conserved

520Gmostly conserved

538Tmostly conserved

553Tvariable

557Cvariable

581Cmostly conserved

637Tmostly conserved

CACCCTCTACCTCCTATTTGGTGCCTGAGCCGGTATAGTAGGAACTGCCTTAAGCTTACTAATTCGCGCTGAACTAGGCCAGCCTGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes10

BINs4

Most divergent pair3.3%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pseudois schaeferisame genus2.6%Capra sibiricasame family8.2%Oreamnos americanussame family9.0%Ovis dallisame family9.0%Capra hircussame family9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_020632 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBs-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Pseudois nayaur carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈2 584 167 189 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Pseudois nayaur2.58 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness60.2% BUSCO

07Deep time~1.04 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin1.04 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

How it livedPBDB

Environmentterrestrial

Life habitground dwelling

Dietgrazer, browser

Motilityactively mobile

Compositionhydroxyapatite

Reproductionviviparous

08Occurrence & distribution

Record type735 records

Wild obs. + sensor687

Museum / vouchered48

Range

Area of Occupancy AOO1 856 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 162≤1 km 97≤10 km 104>10 km 152

515 georeferenced · 172 without coordinates

Open the mapobservation + sensor687

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 1≤10 km 3>10 km 4

8 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence48

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zoological Survey of Indialocation not on record	28
Cambridge, US	3
Denver, US	2
Natural History Museum, Tribhuvan Universitylocation not on record	2
Saint John, CA	2
Museo di Zoologia della Sapienza Università di Romalocation not on record	1
Copenhagen, DK	1
Chicago, US	1

8 institutions · 40 of 48 vouchered records shown · 8 without an institution code

09Environmental DNA67 detections

Where the DNA of Pseudois nayaur was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found67

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 67 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 10.0–25.1

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C 15.7–30.5

Min temp (night)19.3 °C 3.10–19.3

Precipitation109 mm/mo 13.8–109

Air humidity52.0 % 47.6–52.0

Moisture balance-17.8 mm/mo -92.9–-17.8

Vapour deficit1,616 Pa 827–1,616

Wind speed1.80 m/s 1.80–4.10

Cloud cover25.2 % 22.3–25.2

CHELSA 1981–2010, ~9 km grid, at location & month of 37 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)