Pseudogymnoascus destructans

(Blehert & Gargas) Minnis & D.L.Lindner · species

image placeholder — illustration coming later

Fungi/Ascomycota/Leotiomycetes/Thelebolales/Pseudeurotiaceae/Pseudogymnoascus

At a glance

Occurrence records3 527

Data sources8

Biological traits0

DNA specimens75

eDNA detections3 510

Sources8 archives

Databases and archives Pseudogymnoascus destructans's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 527 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 510 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics75 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS8 compounds

Occurrence & distributionGBIF3 527 records

Environmental DNA7 datasets · 19 countries3 510 detections

DNA & barcodingBOLD · NCBI75 specimens

Genome at a glanceGoaT · NCBI≈36 Mbp

01Narrative

Pseudogymnoascus destructans est un champignon psychrophile de la famille des Pseudeurotiaceae, responsable du syndrome du nez blanc, épizootie affectant les chauves-souris en Amérique du Nord, avec un risque sérieux de destruction d'espèces. Contrairement aux espèces de Geomyces, P. destructans forme des conidies asymétriquement incurvées. Pseudogymnoascus destructans pousse très lentement dans des milieux artificiels et ne peut pas croître à des températures supérieures à 20 °C. Il peut croître entre 4 °C à 20 °C, soit les températures trouvées dans les lieux d'hibernation. Une évaluation phylogénique revèle que cet organisme devrait être reclassé sous la famille des Pseudeurotiaceae, changeant son nom en Pseudogymnoascus destructans.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition8 compounds

Compounds documented for Pseudogymnoascus destructans across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Nagilactone diterpenoids5

Tetracyclic diterpenoids1

Anthraquinones and anthrones1

Colensane and Clerodane diterpenoids1

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
1-Chloro-4,5-dihydroxy-2-methoxy-7-methylanthracene-9,10-dione	present	LOTUS
Epi-oidiolactone G	present	LOTUS
Oidiolactone G	present	LOTUS
Oidiolactone H	present	LOTUS
Oidiolactone I	present	LOTUS
Oidiolactone J	present	LOTUS
Oidiolactone K	present	LOTUS
Oidiolactone L	present	LOTUS

05DNA & barcoding75 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pseudogymnoascus destructans has left across the world's sequence archives.

At a glance

DNA specimens75

Marker genes2

GenBank sequences10

eDNA detections3 510

Countries19

The DNA barcodea real sequence read deposited for this species

ITSPP958280.1 ↗392 bpItaly · 2018

ACGT

GAAGGATCATTACAGTAGTCGCCCGGGTTGCCGCAAGGCCTCCCGGGTACCTACCACCCTTTGTTTATTACACTTTGTTGCTTTGGCAGG …

Pseudogymnoascus destructans strain MEGic660 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10

animal barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Pseudogymnoascus destructans carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈35 818 201 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Pseudogymnoascus destructans0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness96.9% BUSCO

08Occurrence & distribution

Record type3 527 records

Wild obs. + sensor19

Museum / vouchered3 508

Range

Area of Occupancy AOO2 436 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy42% within 1 km

≤100 m 5≤1 km 3≤10 km 2>10 km 9

19 georeferenced

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced · 3 506 without coordinates

Open the institutions mapphysical evidence3 508

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
UAclocation not on record	1

1 institutions · 1 of 3 508 vouchered records shown · 3 499 without an institution code

09Environmental DNA3 510 detections

Where the DNA of Pseudogymnoascus destructans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3 510

Studies independent surveys7

Countries19

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 510 detections have coordinates

Open the map19 countries0

IndomalayanNearcticPalearcticAfrotropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature16.9 °C 7.00–29.0

pH5.70 3.10–10.0

Conductivity67.0 µS/cm 5.00–196,750

Organic carbon1.66 % 0.003–16.3

Water content10.8 % 0.232–130

Nitrate-N6.00 mg/kg 0.023–520

Phosphorus15.0 mg/kg 1.00–1,399

Clay16.2 % 0.91–75.9

Sand67.0 % 0–98.1

Depth0 m 0–1.02

SoilMarineCalcarosolPodosolVertosolsKurosolKurosolsVertosol

1 752 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.0 °C -0.2–20.5

Seasonal swing summer↔winter12.0 °C

Max temp (day)19.0 °C 1.40–25.8

Min temp (night)9.00 °C -2.80–15.7

Precipitation55.1 mm/mo 22.6–101

Air humidity58.1 % 52.3–62.5

Moisture balance-40.2 mm/mo

Vapour deficit695 Pa 262–1,064

Wind speed3.60 m/s

Cloud cover24.0 % 13.5–55.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 445 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pseudogymnoascus destructans

At a glance

Sources8 archives

Compound class profile4 classes

Documented compounds8 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type3 527 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type3 527 records