Pseudocyphellaria granulata

(C.Bab.) Malme · species

image placeholder — illustration coming later

Fungi/Ascomycota/Lecanoromycetes/Peltigerales/Lobariaceae/Pseudocyphellaria

At a glance

Occurrence records474

Data sources8

Biological traits0

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Pseudocyphellaria granulata's data was compiled from.

GBIFGlobal Biodiversity Information Facility474 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Chemical compositionLOTUS · NPASS59 compounds

Occurrence & distributionGBIF474 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition59 compounds

Compounds documented for Pseudocyphellaria granulata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Verticillane diterpenoids42

Cholestane steroids2

Xenicane diterpenoids1

Depsidones1

Documented compounds59 total

Tissue Source Quantified only

Compound	Amount	Source
(1aR,3S,4aS,7S,8aS)-7-hydroxy-3-[(1S,2R,3R)-2-(2-hydroxyethyl)-2-methyl-3-[(1S)-1-[(1R,2R)-2-methyl-2-[(2R)-3-methylbutan-2-yl]cyclopropyl]ethyl]cyclopentyl]-4a-methyl-2,3,5,6,7,8-hexahydro-1aH-naphtho[4,4a-b]oxiren-4-one	present	NPASS
(1aR,3S,4aS,7S,8aS)-7-hydroxy-3-[(1S,2R,3R)-2-(2-hydroxyethyl)-2-methyl-3-[(2R)-6-methylheptan-2-yl]cyclopentyl]-4a-methyl-2,3,5,6,7,8-hexahydro-1aH-naphtho[4,4a-b]oxiren-4-one	present	NPASS
(1R,2R,4S,6E,8R,13S,15S)-2-methoxy-6,14,14-trimethyl-10-methylidene-3,16-dioxatetracyclo[11.3.2.01,15.04,15]octadec-6-ene-4,8-diol	present	NPASS
(1R,2S,4S,6E,8R,13S,15S)-2-methoxy-6,14,14-trimethyl-10-methylidene-3,16-dioxatetracyclo[11.3.2.01,15.04,15]octadec-6-ene-4,8-diol	present	NPASS
(1R,3E,10R)-3,17,17-trimethyl-7-methylidene-15-oxatricyclo[8.5.2.013,16]heptadeca-3,13(16)-dien-14-one	present	NPASS
(1R,3E,5R,10R)-1,5-dihydroxy-3,17,17-trimethyl-7-methylidene-15-oxatricyclo[8.5.2.013,16]heptadeca-3,13(16)-dien-14-one	present	NPASS
(1R,3S,7Z,10S)-1-hydroxy-3,7,17,17-tetramethyl-15-oxatricyclo[8.5.2.013,16]heptadeca-7,13(16)-diene-5,14-dione	present	NPASS
(1R,4E,6S,11R)-1,6-dihydroxy-4,15,15-trimethyl-8-methylidenebicyclo[9.3.1]pentadec-4-ene-2,14-dione	present	NPASS
(1R,5E,7S,12R)-7-hydroxy-5,16,16-trimethyl-9-methylidene-2-oxabicyclo[10.3.1]hexadec-5-ene-3,15-dione	present	NPASS
(1S,3E,10S)-3,17,17-trimethyl-7-methylidene-15-oxatricyclo[8.5.2.013,16]heptadeca-3,13(16)-diene-5,14-dione	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pseudocyphellaria granulata has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAF350313.1 ↗637 bp

ACGT

CTGAAAGTAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAGAGGGGCGTCAGCCTCGGGGGCTCCGGCCTC …

Pseudocyphellaria granulata specimen-voucher Thomas 1215 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type474 records

Wild obs. + sensor53

Museum / vouchered421

Origin

Native7

Range

Area of Occupancy AOO1 172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 12≤10 km 5>10 km 1

18 georeferenced · 35 without coordinates

Open the mapobservation + sensor53

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 10≤1 km 65≤10 km 44>10 km 8

127 georeferenced · 294 without coordinates

Open the institutions mapphysical evidence421

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	51
Canberra, AU	41
McWane Science Centerlocation not on record	41
Christchurch, NZ	39
Hobart, AU	37
Wellington, NZ	21
Museo Entomologico de Leonlocation not on record	19
US	16
Bronx, US	14
TROMlocation not on record	13
Berlin, DE	13
ASUlocation not on record	11
Philadelphia, US	10
Uppsala, SE	9
Chicago, US	9
University of Stellenboschlocation not on record	7
Durham, US	7
Mount Annan, AU	7
Museo Achille Folettolocation not on record	6
San Sebastián, ES	6
Universidade de Lisboa, Museu Bocagelocation not on record	6
St. Paul, US	5
DOI/NPS, Colonial National Historical Parklocation not on record	4
Adelaide, AU	4
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	4
Brisbane, AU	3
Rotorua, NZ	3
Madison, US	3
LDlocation not on record	3
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	2
Armidale, AU	1
University of Gdansklocation not on record	1
AASlocation not on record	1
Mlocation not on record	1
CABI Bioscience Genetic Resource Collectionlocation not on record	1
Helsinki, FI	1
Edinburgh, GB	1

37 institutions · 421 of 421 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Pseudocyphellaria granulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)