Pseudocolus fusiformis

(E.Fisch.) Lloyd · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Phallales/Phallaceae/Pseudocolus

At a glance

Occurrence records2 317

Data sources7

Biological traits0

DNA specimens0

eDNA detections180

Sources7 archives

Databases and archives Pseudocolus fusiformis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 317 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI180 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 317 records

Environmental DNA2 datasets · 2 countries180 detections

DNA & barcodingNCBIsequences

01Narrative

Pseudocolus fusiformis is a stinkhorn mushroom in the Phallaceae, a family well known for a remarkable range of fruit body types. It is the most widely distributed member of the genus Pseudocolus and has been found in the United States, Australia, Japan, Java, and the Philippines. It is commonly known as the stinky squid, because of its fetid odor, and its three or four upright "arms" which are connected at the top. The malodorous smell comes from the dark greenish slimy gleba covering the inside faces of the arms, and attracts insects that help to disperse the spores.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pseudocolus fusiformis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences6

eDNA detections180

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMK953935.1 ↗489 bpJapan

ACGT

ATCATTGCTGAATTTATTTTCAATCCTTTCACACACCTGTGCACTCTGGCGCGAGGGGAGACCCTCGTGCGTTATTATTCCCGCCCCCGT …

Pseudocolus fusiformis voucher SDBR-CMUNK0423 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS6

fungal barcode

08Occurrence & distribution

Record type2 317 records

Wild obs. + sensor2 001

Museum / vouchered313

Other3

Range

Area of Occupancy AOO6 248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 1 033≤1 km 273≤10 km 157>10 km 179

1 642 georeferenced · 359 without coordinates

Open the mapobservation + sensor2 001

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 3≤1 km 8≤10 km 19>10 km 2

32 georeferenced · 281 without coordinates

Open the institutions mapphysical evidence313

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	18
Museo Entomologico de Leonlocation not on record	10
KOMlocation not on record	7
Brisbane, AU	6
Auckland, NZ	5
Durham, US	4
Chapel Hill, US	4
Chicago, US	4
Parkville, AU	3
Davis and Elkins Collegelocation not on record	3
DPIlocation not on record	2
Blacksburg, US	2
Odawara, JP	1
San Sebastián, ES	1
TENN-Flocation not on record	1
Champaign, US	1
Canberra, AU	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1
Catholic University of Pekinglocation not on record	1

19 institutions · 75 of 313 vouchered records shown · 238 without an institution code

09Environmental DNA180 detections

Where the DNA of Pseudocolus fusiformis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found180

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 180 detections have coordinates

Open the map2 countries0

Spruce(Softwood) dowel buried in soil of a c…Birch(Hardwood) dowel buried in soil of a co…Pine(Softwood) dowel buried in soil of a con…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature22.7 °C 17.2–28.1

pH7.80 6.79–8.59

Conductivity35,200 µS/cm 27,300–57,083

Salinity29.7 PSU 24.9–38.7

Turbidity1.90 NTU 0–6.90

Nitrate0.527 µmol/L 0.087–1.41

Depth1.00 m 0–3.00

SedimentPelagicCoastal water

129 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 13.0–20.7

Seasonal swing summer↔winter9.30 °C

Max temp (day)18.9 °C 15.4–23.1

Min temp (night)13.7 °C 9.50–19.3

Precipitation107 mm/mo 73.7–126

Air humidity58.3 % 56.4–62.0

Moisture balance17.6 mm/mo -74.1–65.2

Vapour deficit769 Pa 643–940

Wind speed2.70 m/s 2.20–6.10

Cloud cover24.9 % 20.9–30.1

CHELSA 1981–2010, ~9 km grid, at location & month of 180 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pseudocolus fusiformis

At a glance

Sources7 archives

At a glance

Record type2 317 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type2 317 records