Pseudocercospora subsessilis

Fungi/Ascomycota/Dothideomycetes/Mycosphaerellales/Mycosphaerellaceae/Pseudocercospora

At a glance

Occurrence records23

Data sources5

Biological traits0

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Pseudocercospora subsessilis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility23 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF23 records

DNA & barcodingNCBIsequences

01Narrative

Pseudocercospora subsessilis is a fungal plant pathogen infecting mangoes.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pseudocercospora subsessilis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGU269815.1 ↗499 bp

ACGT

AACCTGCGGAGGGATCATTACTGAGTGAGGGCTCACGCCCGACCTCCAACCCTTTGTGAACCAAACTTGTTGCTTCGGGGGCGACCCTGC …

Pseudocercospora subsessilis culture CBS:136.94 strain CBS 136.94 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS3

fungal barcode

08Occurrence & distribution

Record type23 records

Wild obs. + sensor22

Museum / vouchered1

Range

Area of Occupancy AOO76 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 9≤1 km 1

10 georeferenced · 12 without coordinates

Open the mapobservation + sensor22

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	1

1 institutions · 1 of 1 vouchered records shown