Pselliopus barberi

Davis, 1912 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Reduviidae/Pselliopus

At a glance

Occurrence records3 212

Data sources6

Biological traits0

DNA specimens3

eDNA detections3

Sources6 archives

Databases and archives Pselliopus barberi's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility3 212 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 212 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD3 specimens

01Narrative

Pselliopus barberi is a species of assassin bug in the family Reduviidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pselliopus barberi has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

340Tvariable

374Gvariable

473Gvariable

494Avariable

556Tvariable

574Cvariable

619Gvariable

AACTTTATATTTCCTTCTAGGTGCTTGAGCAGGTGTATTGGGCACATCATTAAGATGAGTTATTCGAATTGAATTAGGAATACCAGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.71%

Haplotypes3

BIN1

Most divergent pair0.91%

OtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pselliopus zebrasame genus5.3%Serendiba hymenopterasame family14.1%Acanthischium maculatumsame family14.4%Isyndus reticulatussame family14.9%Zelus tetracanthussame family15.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 212 records

Wild obs. + sensor3 095

Museum / vouchered117

Range

Area of Occupancy AOO8 844 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 1 661≤1 km 457≤10 km 135>10 km 352

2 605 georeferenced · 490 without coordinates

Open the mapobservation + sensor3 095

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤1 km 8≤10 km 25

33 georeferenced · 84 without coordinates

Open the institutions mapphysical evidence117

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
OSUClocation not on record	66
Champaign, US	37
Mississippi State, US	4
Washington, US	3
University of Central Floridalocation not on record	2
CUlocation not on record	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
University Park, US	1
North Carolina State University Insect Museumlocation not on record	1

9 institutions · 116 of 117 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Pselliopus barberi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.5 °C 9.40–25.5

Seasonal swing summer↔winter23.9 °C

Max temp (day)23.0 °C 14.8–31.1

Min temp (night)12.6 °C 4.20–21.0

Precipitation90.4 mm/mo 90.0–90.7

Air humidity56.8 % 54.9–58.6

Moisture balance-33.2 mm/mo -75.2–8.90

Vapour deficit990 Pa 574–1,406

Wind speed2.70 m/s 2.30–3.10

Cloud cover37.0 % 30.8–43.2

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pselliopus barberi

At a glance

Sources6 archives

At a glance

Record type3 212 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 212 records