Pselactus spadix

(J.F.W.Herbst, 1795) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Curculionidae/Pselactus

At a glance

Occurrence records310

Data sources7

Biological traits2

DNA specimens12

eDNA detections9

Sources7 archives

Databases and archives Pselactus spadix's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility310 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF310 records

Environmental DNA1 datasets · 4 countries9 detections

DNA & barcodingBOLD12 specimens

01Narrative

Pselactus spadix is a species of weevil native to Europe.Fauna EuropaeaCsiki E. ,1936 Curculionidae: Rhynchophorinae, Cossoninae. In: Schenkling S. (Ed.) Coleopterorum Catalogues auspiciis et auxilio W. Junk, 149: 1–212Hoffmann, A. (1950, 1954, 1958) Coléoptères curculionides. Parties I, II, III. Paris: Éditions Faune de France. Bibliothèque virtuelle numérique pdfs

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pselactus spadix has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections9

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

328Amostly conserved

583Tmostly conserved

598Cmostly conserved

622Cvariable

628Gvariable

643Avariable

AACCCTATATTTTATTTTAGGAGCATGATCAGGGATAGCAGGAACTTCCCTAAGAATAATAATTCGTATCGAATTAGGAACCCCCGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.38%

Haplotypes4

BIN1

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Caulotrupis lourencoensissame family14.5%Pselactus affinissame genus14.9%Barretonus hinterseherisame family15.7%Pseudophloeophagus tenaxsame family16.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type310 records

Wild obs. + sensor188

Museum / vouchered101

Fossil19

Other2

Range

Area of Occupancy AOO696 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 73≤1 km 59≤10 km 40>10 km 3

175 georeferenced · 13 without coordinates

Open the mapobservation + sensor188

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 16≤1 km 26≤10 km 29>10 km 1

72 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence101

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	37
Muzeum Górnośląskie w Bytomiulocation not on record	11
MZLUlocation not on record	6
Santa Barbara Museum of Natural Historylocation not on record	5
MNHWlocation not on record	4
ASUlocation not on record	4
Tartu, EE	3
CBDClocation not on record	2
University of Alabamalocation not on record	2
South Kensington, GB	2
Bavarian State Collection of Zoologylocation not on record	2
Natural History Museum, Londonlocation not on record	2
Natural History Museum Rotterdamlocation not on record	2
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	2
Museums Victorialocation not on record	1
BioFokuslocation not on record	1
Uniwersytet Jagiellońskilocation not on record	1
ZMUNlocation not on record	1
Office National des Forets, Laboratoire National d'Entomologie Forestierelocation not on record	1
Tilburg, NL	1

20 institutions · 90 of 101 vouchered records shown · 11 without an institution code

09Environmental DNA9 detections

Where the DNA of Pselactus spadix was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.5 °C 14.5–18.7

Seasonal swing summer↔winter13.2 °C

Max temp (day)18.2 °C 16.8–22.3

Min temp (night)16.2 °C 11.0–17.1

Precipitation39.1 mm/mo 21.6–107

Air humidity60.1 % 56.4–64.6

Moisture balance-59.8 mm/mo

Vapour deficit745 Pa 631–911

Wind speed4.80 m/s

Cloud cover39.2 % 37.2–44.3

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)