Psathyrella aquatica

J.L.Frank, Coffan & D.Southw. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Psathyrellaceae/Psathyrella

At a glance

Occurrence records28

Data sources8

Biological traits0

DNA specimens5

eDNA detections5

Sources8 archives

Databases and archives Psathyrella aquatica's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility28 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF28 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Psathyrella aquatica is a species of fungus from Oregon, first described in the journal Mycologia in 2010. It represents the first ever report of a gilled basidiomycete fruiting underwater.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psathyrella aquatica has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes2

GenBank sequences9

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU664991.1 ↗401 bp

ACGT

CATGTGCACGCCCGTCATTCATATCTTTCCACCTGTGAACTCACTGTAGGTCTGGATAACTCTCGCTTACCCAAGCGGAAGCAAGGATTG …

Psathyrella aquatica voucher SOC1090 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9★ITS1

fungal barcode

08Occurrence & distribution

Record type28 records

Wild obs. + sensor22

Museum / vouchered6

Range

Area of Occupancy AOO68 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 8≤1 km 3≤10 km 4>10 km 3

18 georeferenced · 4 without coordinates

Open the mapobservation + sensor22

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the institutions mapphysical evidence6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ashland, US	3
California State University, East Baylocation not on record	1

2 institutions · 4 of 6 vouchered records shown · 2 without an institution code

09Environmental DNA5 detections

Where the DNA of Psathyrella aquatica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 13.2–13.2

Seasonal swing summer↔winter20.5 °C

Max temp (day)20.9 °C

Min temp (night)5.90 °C

Precipitation19.2 mm/mo

Air humidity46.7 %

Moisture balance-146 mm/mo

Vapour deficit820 Pa

Wind speed2.40 m/s

Cloud cover24.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)