Psammophora modesta

(Dinter & A.Berger) Dinter & Schwantes · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Aizoaceae/Psammophora

At a glance

Occurrence records139

Data sources4

Biological traits18

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Psammophora modesta's data was compiled from.

GBIFGlobal Biodiversity Information Facility139 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources18 traits

Chemical compositionLOTUS6 compounds

Occurrence & distributionGBIF139 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height max0.15 m

Seed mass23.78 mg

Seed mass max30.37 mg

Seed mass min17.19 mg

Life cycle & reproduction3

Deciduousnessdeciduous

Life formsucculent subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max1 050 m

Elevation min10 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayCAM

Other traits1

Plant support typefree-standing

03Chemical composition6 compounds

Compounds documented for Psammophora modesta across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Betalain alkaloids6

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
(2R)-1-[(2E)-2-[(2R)-2,6-dicarboxy-2,3-dihydro-1H-pyridin-4-ylidene]ethylidene]-6-hydroxy-5-[(2R,3S,4R,5S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,3-dihydroindol-1-ium-2-carboxylate	present	LOTUS
(2S)-1-[2-[(2S)-2,6-dicarboxy-2,3-dihydro-1H-pyridin-4-ylidene]ethylidene]-6-hydroxy-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,3-dihydroindol-1-ium-2-carboxylate	present	LOTUS
(2S)-4-[2-[(2S)-2-carboxy-6-hydroxy-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,3-dihydroindol-1-yl]ethenyl]-2,3-dihydropyridine-2,6-dicarboxylic acid	present	LOTUS
Betanidin	present	LOTUS
Betanidine	present	LOTUS
Betanin	present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psammophora modesta has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

matKKF132742.1 ↗777 bp

ACGT

TACTGGGTAAAAGATGCCTCCTCTTTGCATTTATTACGATTCTTTCTTTATGGGTATCATAATTGGAATAGTCTTATTACTTCAAAAGAA …

Psammophora modesta voucher Mannheimer 2141 (BOL) maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

08Occurrence & distribution

Record type139 records

Wild obs. + sensor45

Museum / vouchered94

Range

Area of Occupancy AOO472 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 30≤1 km 5>10 km 10

45 georeferenced

Open the mapobservation + sensor45

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 94 records without

Open the institutions mapphysical evidence94

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Hamburglocation not on record	74
Pretoria, ZA	20

2 institutions · 94 of 94 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)