Psammophiliella muralis

(L.) Ikonn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Caryophyllaceae/Psammophiliella

At a glance

Occurrence records8 001

Data sources10

Biological traits45

DNA specimens10

eDNA detections6

Sources10 archives

Databases and archives Psammophiliella muralis's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 001 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources45 traits

Occurrence & distributionGBIF8 001 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceCCDB2n = 34

01Narrative

Psammophiliella is a genus of flowering plants in the family Caryophyllaceae. It has only one species, Psammophiliella muralis (synonym Gypsophila muralis), known as annual gypsophila, cushion baby's-breath and low baby's-breath, an annual plant principally native to Europe except the British Isles. It can be also found in Central Asia, Turkey, the Caucasus, and Siberia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology14

Leaf length15 mm

Leaf length max25 mm

Leaf length min5 mm

Leaf width max2.5 mm

Leaf width min1 mm

Plant height0.122 m

⚠ sources differ — GIFT: 0.122 m · LEDA: 0.12 m · TRY: 0.2 m

Plant height generative0.145 m

Plant height max0.2 m

Plant height min0.05 m

Seed length0.33 mm

Seed mass0.032 mg

Seed volume0.024 mm³

Seed volume max0.024 mm³

Seed volume min0.024 mm³

Life cycle & reproduction14

Deciduousnessaestival

⚠ sources differ — TRY: aestival · GIFT: deciduous

Dehiscencedehiscent

Dispersal typeanimal

⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous

Flowering endOct

Flowering startJun

Life formannual

Life spanannual

Lifespan years5 years

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formtherophyte

Reproduction asexualabsent

Seed number550

Self fertilizationabsent

Diet & foraging2

Carnivorynon-carnivorous

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Habitat GIFTcrop fields, indoor, meadows: wet, roadsides

Woodinessnon-woody

Physiology & chemistry4

Leaf dry-matter content (LDMC)300 mg/g

Photosynthetic pathwayC3

Seed longevity index0.5

Specific leaf area (SLA)67.31 mm²/mg

Other traits2

Diaspore typeone-seeded generative dispersule

Shoot orientationerect

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psammophiliella muralis has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes5

GenBank sequences8

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPQ452380.1 ↗291 bpKazakhstan

ACGT

GCCAAGCAGAACGACCCGTGAACACTTTCAAAATTCATGGGATTGGAGTTTGCATGGTACCTTGTGTGCCTTGCTACAACAATCCCAAGC …

Psammophiliella muralis voucher KS23 HER0299 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★rbcLa★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Psammophiliella muralis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidypolyploid inferred

Chromosome records30–342n range34median34mode20records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 3416×CCDB · slov-fl · CCDB · poland · CCDB · mediterranean +5

CCDB · slov-fl — Váchová M. & Feráková V., 1980: [Report], pp. 722-723. - In: Löve Á. (ed.), Chromosome numbers reports LXIX, Taxon 29 /5-6.

CCDB · slov-fl — Váchová M. & Feráková V., 1978: [Report], pp. 382-383. - In: Löve Á. (ed.), IOPB Chromosome number reports LXI, Taxon 27 /4.

CCDB · poland — Pogan E., Jankun A., Wcis?o H. et al. 1990. Further studies in chromosome numbers of Polish Angiosperms. Part XXIII. Acta Biol. Cracov. Ser. Bot. 32, 171-188.

CCDB · mediterranean

CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Izmai|1low, R. 1990. In Further studies in chromosome numbers of Polish angiosperms, part 23. Acta Biol. Cracov., Ser. Bot. 32: 173–177.

CCDB · ipcn-api-dl — Tiniakou, A. 1996. Mediterranean chromosome number reports 6 (773--778). Fl. Medit. 6: 333–337.

CCDB · ipcn-api-dl — Vachova, M. & V. Ferakova. 1980. In Chromosome number reports LXIX. Taxon 29: 722–723.

CCDB · ipcn-api-dl — Probatova. 2005. Chromosome numbers of some dicotyledons of the flora of the Amur Region. Bot. Žhurn. (Moscow & Leningrad) 90(5): 779–792.

CCDB · book-ipcn75-78 — Vachova & Ferakova 1978

CCDB · book-fedorov — Love A., Love D. 1942b.

CCDB · book-atlas-flowering-plants — L. & L. 1942b

CCDB · CromoCat 2015 — Tiniakou, A. (1996). Mediterranean chromosome number reports-6. Fl. Medit. 6: 333-337.

CCDB · CromoCat 2015 — Váchová, M. & V. Feráková. (1980). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIX]. Taxon 29(5): 722-723.

CCDB · CromoCat 2015 — Váchová, M. & V. Feráková. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXI]. Taxon 27(4): 382-383.

2n 304×CCDB · ipcn-api-dl · CCDB · CromoCat 2015 · CCDB · iapt

CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.

CCDB · CromoCat 2015 — Javurková-Jarolímová, V. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesíccek & V. Javurková-Jarolímová. Academia, Praha Praha

CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.

CCDB · iapt — IAPT/IOPB Chromosome Data 20

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type8 001 records

Wild obs. + sensor6 720

Museum / vouchered1 277

Other4

Origin

Introduced24

Range

Area of Occupancy AOO18 160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 3 840≤1 km 1 118≤10 km 479>10 km 262

5 699 georeferenced · 1 021 without coordinates

Open the mapobservation + sensor6 720

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 170≤1 km 220≤10 km 181>10 km 271

842 georeferenced · 435 without coordinates

Open the institutions mapphysical evidence1 277

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	409
Helsinki, FI	236
SLU Artdatabankenlocation not on record	144
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	79
BIO-UNIPIlocation not on record	66
Zürich, CH	37
Zürich, CH	34
Turku, FI	33
Oulu, FI	27
Kuopio, FI	12
Tula State Lev Tolstoy Pedagogical Universitylocation not on record	10
IWEP FEB RASlocation not on record	7
TUR-Alocation not on record	5
BClocation not on record	4
Brussel, BE	4
The Tula Region State Institution of Culture "Tula Museum Association"location not on record	3
KIRMlocation not on record	3
Provincia di Livornolocation not on record	3
Finnish Museum of Natural Historylocation not on record	3
Sion, CH	2
Porvoo, FI	2
Sendai, JP	2
MeiseBGlocation not on record	2
Karlsruhe, DE	1
Montréal, CA	1
University of Guelph, OAC Herbariumlocation not on record	1
Iwate Prefectural Museumlocation not on record	1
Chapel Hill, US	1
BRNUlocation not on record	1
Metsähallituslocation not on record	1
Tula State Universitylocation not on record	1

31 institutions · 1 135 of 1 277 vouchered records shown · 142 without an institution code

09Environmental DNA6 detections

Where the DNA of Psammophiliella muralis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median2.90 °C 0–12.6

Seasonal swing summer↔winter23.1 °C

Max temp (day)6.40 °C 3.10–15.9

Min temp (night)0.3 °C -4.10–9.50

Precipitation71.1 mm/mo 55.7–88.2

Air humidity63.0 % 58.8–69.0

Moisture balance1.60 mm/mo -1.50–49.7

Vapour deficit317 Pa 207–593

Wind speed3.40 m/s 3.10–3.60

Cloud cover50.7 % 46.8–57.4

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Psammophiliella muralis

At a glance

Sources10 archives

Size & morphology14

Life cycle & reproduction14

Diet & foraging2

Habitat & environment9

Physiology & chemistry4

Other traits2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type8 001 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type8 001 records